Quick Order

Rat IFN-alpha / IFNA1 / IFN Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat IFNA1 cDNA Clone Product Information
NCBI RefSeq:NM_001014786.1
RefSeq ORF Size:579bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interferon-alpha 1 with C terminal Myc tag.
Gene Synonym:IFN-alpha1, Ifna1
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

References
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Size / Price
    Catalog: RG80174-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"