Fragilis cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80739-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Fragilis Reagents
CRO Services
Product recommended

All Fragilis Reagents
Fragilis cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
414 bp
Description
Full length Clone DNA of Rat interferon induced transmembrane protein 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fragilis Background Information

Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the host cell's resources. Interferon (IFN) regulates the actions of a large complement of interferon effector genes (IEGs) that prevent viral replication. The interferon inducible transmembrane protein family members, IFITM1, 2 and 3, are IEGs required for inhibition of influenza A virus, dengue virus, and West Nile virus replication in vitro. IFITM3 is an IFN-induced antiviral protein that mediates cellular innate immunity to at least three major human pathogens, namely influenza A H1N1 virus, West Nile virus (WNV), and dengue virus (WNV), by inhibiting the early step(s) of replication. It is both necessary and sufficient for preventing the emergence of viral genomes from the endosomal pathway. Viral pseudoparticles were inhibited from transferring their contents into the host cell cytosol by IFN, and IFITM3 was required and sufficient for this action. IFITM3 overexpression is sufficient for this phenotype. Moreover, IFITM3 partially resides in late endosomal and lysosomal structures, placing it in the path of invading viruses.

Full Name
interferon induced transmembrane protein 3
References
  • Tanaka SS, et al. (2005) IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev Cell. 9(6):745-56.
  • Li D, et al. (2011) KLF4-mediated negative regulation of IFITM3 expression plays a critical role in colon cancer pathogenesis. Clin Cancer Res. 17(11):3558-68.
  • Lu J, et al. (2011) The IFITM proteins inhibit HIV-1 infection. J Virol. 85(5):2126-37.
  • Fragilis cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Fragilis cDNA ORF Clone in Cloning Vector, Rat RG80739-U
    Fragilis cDNA ORF Clone, Rat, untagged RG80739-UT
    Fragilis cDNA ORF Clone, Rat, C-GFPSpark® tag RG80739-ACG
    Fragilis Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80739-ACGLN
    Fragilis cDNA ORF Clone, Rat, C-OFPSpark® tag RG80739-ACR
    Fragilis cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80739-CF
    Fragilis cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80739-NF
    Fragilis cDNA ORF Clone, Rat, C-His tag RG80739-CH
    Fragilis cDNA ORF Clone, Rat, N-His tag RG80739-NH
    Fragilis cDNA ORF Clone, Rat, C-HA tag RG80739-CY
    Fragilis cDNA ORF Clone, Rat, N-HA tag RG80739-NY
    Fragilis cDNA ORF Clone, Rat, C-Myc tag RG80739-CM
    Fragilis qPCR Primer Pairs, Rat RP300703

    Fragilis cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Fragilis cDNA ORF Clone in Cloning Vector, Mouse MG58853-U
    Fragilis cDNA ORF Clone, Mouse, untagged MG58853-UT
    Fragilis cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58853-ACG
    Fragilis Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58853-ACGLN
    Fragilis cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58853-ANG
    Fragilis cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58853-ACR
    Fragilis cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58853-ANR
    Fragilis cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58853-CF
    Fragilis cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58853-NF
    Fragilis cDNA ORF Clone, Mouse, C-His tag MG58853-CH
    Fragilis cDNA ORF Clone, Mouse, N-His tag MG58853-NH
    Fragilis cDNA ORF Clone, Mouse, C-HA tag MG58853-CY
    Fragilis cDNA ORF Clone, Mouse, N-HA tag MG58853-NY
    Fragilis cDNA ORF Clone, Mouse, C-Myc tag MG58853-CM
    Fragilis cDNA ORF Clone, Mouse, N-Myc tag MG58853-NM

    Fragilis cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Fragilis cDNA ORF Clone in Cloning Vector, Human HG14141-G
    Fragilis cDNA ORF Clone, Human, untagged HG14141-UT
    Fragilis Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14141-ACGLN
    Fragilis Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12431-ACGLN
    Fragilis cDNA ORF Clone, Human, C-GFPSpark® tag HG14141-ACG
    Fragilis cDNA ORF Clone, Human, C-OFPSpark® tag HG14141-ACR
    Fragilis cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14141-CF
    Fragilis cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14141-NF
    Fragilis cDNA ORF Clone, Human, C-His tag HG14141-CH
    Fragilis cDNA ORF Clone, Human, N-His tag HG14141-NH
    Fragilis cDNA ORF Clone, Human, C-HA tag HG14141-CY
    Fragilis cDNA ORF Clone, Human, N-HA tag HG14141-NY
    Fragilis cDNA ORF Clone, Human, C-Myc tag HG14141-CM
    Fragilis cDNA ORF Clone, Human, N-Myc tag HG14141-NM
    Fragilis qPCR Primer Pairs, Human HP102793
    info info
    添加购物车成功! 添加购物车失败!