IFIT1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80925-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IFIT1 Reagents
CRO Services
Product recommended

All IFIT1 Reagents
IFIT1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1392 bp
Description
Full length Clone DNA of Rat interferon-induced protein with tetratricopeptide repeats 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFIT1 Background Information
Full Name
interferon-induced protein with tetratricopeptide repeats 1

IFIT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IFIT1 cDNA ORF Clone in Cloning Vector, Rat RG80925-U
IFIT1 cDNA ORF Clone, Rat, untagged RG80925-UT
IFIT1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80925-ACG
IFIT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80925-ACGLN
IFIT1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80925-ANG
IFIT1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80925-ACR
IFIT1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80925-ANR
IFIT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80925-CF
IFIT1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80925-NF
IFIT1 cDNA ORF Clone, Rat, C-His tag RG80925-CH
IFIT1 cDNA ORF Clone, Rat, N-His tag RG80925-NH
IFIT1 cDNA ORF Clone, Rat, C-HA tag RG80925-CY
IFIT1 cDNA ORF Clone, Rat, N-HA tag RG80925-NY
IFIT1 cDNA ORF Clone, Rat, C-Myc tag RG80925-CM
IFIT1 qPCR Primer Pairs, Rat RP300889

IFIT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IFIT1 cDNA ORF Clone in Cloning Vector, Mouse MG59960-U
IFIT1 cDNA ORF Clone, Mouse, untagged MG59960-UT
IFIT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59960-ACGLN
IFIT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59960-ACG
IFIT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59960-ANG
IFIT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59960-ACR
IFIT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59960-ANR
IFIT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59960-CF
IFIT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59960-NF
IFIT1 cDNA ORF Clone, Mouse, C-His tag MG59960-CH
IFIT1 cDNA ORF Clone, Mouse, N-His tag MG59960-NH
IFIT1 cDNA ORF Clone, Mouse, C-HA tag MG59960-CY
IFIT1 cDNA ORF Clone, Mouse, N-HA tag MG59960-NY
IFIT1 cDNA ORF Clone, Mouse, C-Myc tag MG59960-CM
IFIT1 cDNA ORF Clone, Mouse, N-Myc tag MG59960-NM

IFIT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IFIT1 cDNA ORF Clone in Cloning Vector, Human HG18839-U
IFIT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18839-ACGLN
info info
添加购物车成功! 添加购物车失败!