IFI47 cDNA ORF Clone, Rat, untagged

Cat: RG81100-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IFI47 Reagents
CRO Services
Product recommended

All IFI47 Reagents
IFI47 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Description
Full length Clone DNA of Rat interferon gamma inducible protein 47.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFI47 Background Information
Full Name
interferon gamma inducible protein 47

IFI47 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IFI47 cDNA ORF Clone in Cloning Vector, Rat RG81100-U
IFI47 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81100-ACGLN
IFI47 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81100-ACG
IFI47 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81100-ANG
IFI47 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81100-ACR
IFI47 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81100-ANR
IFI47 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81100-CF
IFI47 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81100-NF
IFI47 cDNA ORF Clone, Rat, C-His tag RG81100-CH
IFI47 cDNA ORF Clone, Rat, N-His tag RG81100-NH
IFI47 cDNA ORF Clone, Rat, C-HA tag RG81100-CY
IFI47 cDNA ORF Clone, Rat, N-HA tag RG81100-NY
IFI47 cDNA ORF Clone, Rat, C-Myc tag RG81100-CM
IFI47 cDNA ORF Clone, Rat, N-Myc tag RG81100-NM
IFI47 qPCR Primer Pairs, Rat RP301057

IFI47 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IFI47 cDNA ORF Clone in Cloning Vector, Mouse MG53052-G
IFI47 cDNA ORF Clone, Mouse, untagged MG53052-UT
IFI47 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53052-ACGLN
IFI47 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53052-ACG
IFI47 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53052-ACR
IFI47 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53052-CF
IFI47 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53052-NF
IFI47 cDNA ORF Clone, Mouse, C-His tag MG53052-CH
IFI47 cDNA ORF Clone, Mouse, N-His tag MG53052-NH
IFI47 cDNA ORF Clone, Mouse, C-HA tag MG53052-CY
IFI47 cDNA ORF Clone, Mouse, N-HA tag MG53052-NY
IFI47 cDNA ORF Clone, Mouse, C-Myc tag MG53052-CM
IFI47 cDNA ORF Clone, Mouse, N-Myc tag MG53052-NM
info info
添加购物车成功! 添加购物车失败!