IDH3A cDNA ORF Clone, Rat, N-His tag

Cat: RG80598-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IDH3A Reagents
CRO Services
Product recommended

All IDH3A Reagents
IDH3A cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1101 bp
Description
Full length Clone DNA of Rat isocitrate dehydrogenase 3 (NAD+) alpha with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDH3A Background Information
Full Name
isocitrate dehydrogenase 3 (NAD+) alpha

IDH3A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IDH3A cDNA ORF Clone in Cloning Vector, Rat RG80598-U
IDH3A cDNA ORF Clone, Rat, untagged RG80598-UT
IDH3A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80598-ACG
IDH3A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80598-ACGLN
IDH3A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80598-ANG
IDH3A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80598-ACR
IDH3A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80598-ANR
IDH3A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80598-CF
IDH3A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80598-NF
IDH3A cDNA ORF Clone, Rat, C-His tag RG80598-CH
IDH3A cDNA ORF Clone, Rat, C-HA tag RG80598-CY
IDH3A cDNA ORF Clone, Rat, N-HA tag RG80598-NY
IDH3A cDNA ORF Clone, Rat, C-Myc tag RG80598-CM
IDH3A cDNA ORF Clone, Rat, N-Myc tag RG80598-NM
IDH3A qPCR Primer Pairs, Rat RP300562

IDH3A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IDH3A cDNA ORF Clone in Cloning Vector, Mouse MG53630-U
IDH3A cDNA ORF Clone, Mouse, untagged MG53630-UT
IDH3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53630-ACG
IDH3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53630-ACGLN
IDH3A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53630-ANG
IDH3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53630-ACR
IDH3A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53630-ANR
IDH3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53630-CF
IDH3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53630-NF
IDH3A cDNA ORF Clone, Mouse, C-His tag MG53630-CH
IDH3A cDNA ORF Clone, Mouse, N-His tag MG53630-NH
IDH3A cDNA ORF Clone, Mouse, C-HA tag MG53630-CY
IDH3A cDNA ORF Clone, Mouse, N-HA tag MG53630-NY
IDH3A cDNA ORF Clone, Mouse, C-Myc tag MG53630-CM
IDH3A cDNA ORF Clone, Mouse, N-Myc tag MG53630-NM

IDH3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IDH3A cDNA ORF Clone in Cloning Vector, Human HG15463-G
IDH3A cDNA ORF Clone, Human, untagged HG15463-UT
IDH3A cDNA ORF Clone, Human, C-GFPSpark® tag HG15463-ACG
IDH3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15463-ACGLN
IDH3A cDNA ORF Clone, Human, N-GFPSpark® tag HG15463-ANG
IDH3A cDNA ORF Clone, Human, C-OFPSpark® tag HG15463-ACR
IDH3A cDNA ORF Clone, Human, N-OFPSpark® tag HG15463-ANR
IDH3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15463-CF
IDH3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15463-NF
IDH3A cDNA ORF Clone, Human, C-His tag HG15463-CH
IDH3A cDNA ORF Clone, Human, N-His tag HG15463-NH
IDH3A cDNA ORF Clone, Human, C-HA tag HG15463-CY
IDH3A cDNA ORF Clone, Human, N-HA tag HG15463-NY
IDH3A cDNA ORF Clone, Human, C-Myc tag HG15463-CM
IDH3A cDNA ORF Clone, Human, N-Myc tag HG15463-NM
IDH3A qPCR Primer Pairs, Human HP104086
info info
添加购物车成功! 添加购物车失败!