ICOS cDNA ORF Clone, Rat, N-His tag

Cat: RG80381-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ICOS Reagents
CRO Services
Product recommended

All ICOS Reagents
ICOS cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Rat inducible T-cell co-stimulator with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ICOS Background Information

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

Immune Checkpoint
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
inducible T-cell co-stimulator
References
  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.
  • ICOS cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Cynomolgus CG90866-G

    ICOS cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Rat RG80381-G
    ICOS cDNA ORF Clone, Rat, untagged RG80381-UT
    ICOS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80381-ACGLN
    ICOS cDNA ORF Clone, Rat, C-GFPSpark® tag RG80381-ACG
    ICOS cDNA ORF Clone, Rat, C-OFPSpark® tag RG80381-ACR
    ICOS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80381-CF
    ICOS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80381-NF
    ICOS cDNA ORF Clone, Rat, C-His tag RG80381-CH
    ICOS cDNA ORF Clone, Rat, C-HA tag RG80381-CY
    ICOS cDNA ORF Clone, Rat, N-HA tag RG80381-NY
    ICOS cDNA ORF Clone, Rat, C-Myc tag RG80381-CM
    ICOS cDNA ORF Clone, Rat, N-Myc tag RG80381-NM
    ICOS qPCR Primer Pairs, Rat RP300348

    ICOS cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Mouse MG50466-M
    ICOS cDNA ORF Clone, Mouse, untagged MG50466-UT
    ICOS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50466-ACG
    ICOS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50466-ACGLN
    ICOS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50466-ACR
    ICOS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50466-CF
    ICOS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50466-NF
    ICOS cDNA ORF Clone, Mouse, C-His tag MG50466-CH
    ICOS cDNA ORF Clone, Mouse, N-His tag MG50466-NH
    ICOS cDNA ORF Clone, Mouse, C-HA tag MG50466-CY
    ICOS cDNA ORF Clone, Mouse, N-HA tag MG50466-NY
    ICOS cDNA ORF Clone, Mouse, C-Myc tag MG50466-CM
    ICOS cDNA ORF Clone, Mouse, N-Myc tag MG50466-NM
    ICOS qPCR Primer Pairs, Mouse MP201027

    ICOS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Human HG10344-M
    ICOS cDNA ORF Clone, Human, untagged HG10344-UT
    ICOS cDNA ORF Clone, Human, C-GFPSpark® tag HG10344-ACG
    ICOS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10344-ACGLN
    ICOS cDNA ORF Clone, Human, C-OFPSpark® tag HG10344-ACR
    ICOS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10344-CF
    ICOS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10344-NF
    ICOS cDNA ORF Clone, Human, C-His tag HG10344-CH
    ICOS cDNA ORF Clone, Human, N-His tag HG10344-NH
    ICOS cDNA ORF Clone, Human, C-HA tag HG10344-CY
    ICOS cDNA ORF Clone, Human, N-HA tag HG10344-NY
    ICOS cDNA ORF Clone, Human, C-Myc tag HG10344-CM
    ICOS cDNA ORF Clone, Human, N-Myc tag HG10344-NM
    ICOS qPCR Primer Pairs, Human HP100382
    info info
    添加购物车成功! 添加购物车失败!