Quick Order

Rat HSPD1/HSP60 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat HSPD1 cDNA Clone Product Information
NCBI RefSeq:NM_022229.2
RefSeq ORF Size:1722bp
cDNA Description:Full length Clone DNA of Rattus norvegicus heat shock protein 1 (chaperonin).
Gene Synonym:Hsp60, Hspd1-30p
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

HSPD1, also known as HSP60, is a member of the chaperonin family. HSPD1 may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. It may also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. HSPD1 gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.Defects in HSPD1 are a cause of spastic paraplegia autosomal dominant type 13 (SPG13). Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Defects in HSPD1 are the cause of leukodystrophy hypomyelinating type 4 (HLD4); also called mitochondrial HSP60 chaperonopathy or MitCHAP-60 disease. HLD4 is a severe autosomal recessive hypomyelinating leukodystrophy. HSPD1 is cinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurrs within the first two decades of life.

References
  • Hansen J J, et al. (2002) Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60. Am J Hum Genet. 70: 1328-32.
  • Magen D, et al. (2008) Mitochondrial Hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet. 83: 30-42.
  • Venner TJ, et al. (1990) Nucleotide sequences and novel structural features of human and Chinese hamster hsp60 (chaperonin) gene families. DNA Cell Biol. 9 (8): 545-52.
  • Size / Price
    Catalog: RG81014-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"