HSPA9/Grp75 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81594-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSPA9/Grp75 Reagents
CRO Services
Product recommended

All HSPA9/Grp75 Reagents
HSPA9/Grp75 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2040 bp
Description
Full length Clone DNA of Rat heat shock protein 9 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSPA9/Grp75 Background Information
Full Name
heat shock 70kDa protein 9 (mortalin)

HSPA9/Grp75 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSPA9/Grp75 cDNA ORF Clone in Cloning Vector, Rat RG81594-G
HSPA9/Grp75 cDNA ORF Clone, Rat, untagged RG81594-UT
HSPA9/Grp75 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81594-ACG
HSPA9/Grp75 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81594-ACGLN
HSPA9/Grp75 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81594-ANG
HSPA9/Grp75 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81594-ACR
HSPA9/Grp75 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81594-ANR
HSPA9/Grp75 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81594-CF
HSPA9/Grp75 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81594-NF
HSPA9/Grp75 cDNA ORF Clone, Rat, C-His tag RG81594-CH
HSPA9/Grp75 cDNA ORF Clone, Rat, N-His tag RG81594-NH
HSPA9/Grp75 cDNA ORF Clone, Rat, C-HA tag RG81594-CY
HSPA9/Grp75 cDNA ORF Clone, Rat, N-HA tag RG81594-NY
HSPA9/Grp75 cDNA ORF Clone, Rat, N-Myc tag RG81594-NM

HSPA9/Grp75 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSPA9/Grp75 cDNA ORF Clone in Cloning Vector, Human HG16926-U
HSPA9/Grp75 cDNA ORF Clone, Human, untagged HG16926-UT
HSPA9/Grp75 cDNA ORF Clone, Human, C-GFPSpark® tag HG16926-ACG
HSPA9/Grp75 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16926-ACGLN
HSPA9/Grp75 cDNA ORF Clone, Human, N-GFPSpark® tag HG16926-ANG
HSPA9/Grp75 cDNA ORF Clone, Human, C-OFPSpark® tag HG16926-ACR
HSPA9/Grp75 cDNA ORF Clone, Human, N-OFPSpark® tag HG16926-ANR
HSPA9/Grp75 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16926-CF
HSPA9/Grp75 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16926-NF
HSPA9/Grp75 cDNA ORF Clone, Human, C-His tag HG16926-CH
HSPA9/Grp75 cDNA ORF Clone, Human, N-His tag HG16926-NH
HSPA9/Grp75 cDNA ORF Clone, Human, C-HA tag HG16926-CY
HSPA9/Grp75 cDNA ORF Clone, Human, N-HA tag HG16926-NY
HSPA9/Grp75 cDNA ORF Clone, Human, C-Myc tag HG16926-CM
HSPA9/Grp75 cDNA ORF Clone, Human, N-Myc tag HG16926-NM
info info
添加购物车成功! 添加购物车失败!