HSD3B1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80615-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSD3B1 Reagents
CRO Services
Product recommended

All HSD3B1 Reagents
HSD3B1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1122 bp
Description
Full length Clone DNA of Rat hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSD3B1 Background Information
Full Name
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

HSD3B1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSD3B1 cDNA ORF Clone in Cloning Vector, Rat RG80615-U
HSD3B1 cDNA ORF Clone, Rat, untagged RG80615-UT
HSD3B1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80615-ACG
HSD3B1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80615-ACGLN
HSD3B1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80615-ANG
HSD3B1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80615-ACR
HSD3B1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80615-ANR
HSD3B1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80615-CF
HSD3B1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80615-NF
HSD3B1 cDNA ORF Clone, Rat, N-His tag RG80615-NH
HSD3B1 cDNA ORF Clone, Rat, C-HA tag RG80615-CY
HSD3B1 cDNA ORF Clone, Rat, N-HA tag RG80615-NY
HSD3B1 cDNA ORF Clone, Rat, C-Myc tag RG80615-CM
HSD3B1 cDNA ORF Clone, Rat, N-Myc tag RG80615-NM
HSD3B1 qPCR Primer Pairs, Rat RP300579

HSD3B1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSD3B1 cDNA ORF Clone in Cloning Vector, Mouse MG53329-G
HSD3B1 cDNA ORF Clone, Mouse, untagged MG53329-UT
HSD3B1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53329-ACGLN
HSD3B1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53329-ACG
HSD3B1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53329-ANG
HSD3B1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53329-ACR
HSD3B1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53329-ANR
HSD3B1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53329-CF
HSD3B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53329-NF
HSD3B1 cDNA ORF Clone, Mouse, C-His tag MG53329-CH
HSD3B1 cDNA ORF Clone, Mouse, N-His tag MG53329-NH
HSD3B1 cDNA ORF Clone, Mouse, C-HA tag MG53329-CY
HSD3B1 cDNA ORF Clone, Mouse, N-HA tag MG53329-NY
HSD3B1 cDNA ORF Clone, Mouse, C-Myc tag MG53329-CM
HSD3B1 cDNA ORF Clone, Mouse, N-Myc tag MG53329-NM

HSD3B1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSD3B1 cDNA ORF Clone in Cloning Vector, Human HG14410-G
HSD3B1 cDNA ORF Clone, Human, untagged HG14410-UT
HSD3B1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14410-ACG
HSD3B1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14410-ACGLN
HSD3B1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14410-ANG
HSD3B1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14410-ACR
HSD3B1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14410-ANR
HSD3B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14410-CF
HSD3B1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14410-NF
HSD3B1 cDNA ORF Clone, Human, C-His tag HG14410-CH
HSD3B1 cDNA ORF Clone, Human, N-His tag HG14410-NH
HSD3B1 cDNA ORF Clone, Human, C-HA tag HG14410-CY
HSD3B1 cDNA ORF Clone, Human, N-HA tag HG14410-NY
HSD3B1 cDNA ORF Clone, Human, C-Myc tag HG14410-CM
HSD3B1 cDNA ORF Clone, Human, N-Myc tag HG14410-NM
HSD3B1 qPCR Primer Pairs, Human HP103059
info info
添加购物车成功! 添加购物车失败!