HSD17B10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81291-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSD17B10 Reagents
CRO Services
Product recommended

All HSD17B10 Reagents
HSD17B10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Rat hydroxysteroid (17-beta) dehydrogenase 10 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSD17B10 Background Information
Full Name
hydroxysteroid (17-beta) dehydrogenase 10
Research Areas

HSD17B10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSD17B10 cDNA ORF Clone in Cloning Vector, Rat RG81291-U
HSD17B10 cDNA ORF Clone, Rat, untagged RG81291-UT
HSD17B10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81291-ACGLN
HSD17B10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81291-ACG
HSD17B10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81291-ANG
HSD17B10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81291-ACR
HSD17B10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81291-ANR
HSD17B10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81291-NF
HSD17B10 cDNA ORF Clone, Rat, C-His tag RG81291-CH
HSD17B10 cDNA ORF Clone, Rat, N-His tag RG81291-NH
HSD17B10 cDNA ORF Clone, Rat, C-HA tag RG81291-CY
HSD17B10 cDNA ORF Clone, Rat, N-HA tag RG81291-NY
HSD17B10 cDNA ORF Clone, Rat, C-Myc tag RG81291-CM
HSD17B10 cDNA ORF Clone, Rat, N-Myc tag RG81291-NM
HSD17B10 qPCR Primer Pairs, Rat RP301247

HSD17B10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSD17B10 cDNA ORF Clone in Cloning Vector, Mouse MG53904-U
HSD17B10 cDNA ORF Clone, Mouse, untagged MG53904-UT
HSD17B10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53904-ACGLN
HSD17B10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53904-ACG
HSD17B10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53904-ANG
HSD17B10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53904-ACR
HSD17B10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53904-ANR
HSD17B10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53904-CF
HSD17B10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53904-NF
HSD17B10 cDNA ORF Clone, Mouse, C-His tag MG53904-CH
HSD17B10 cDNA ORF Clone, Mouse, N-His tag MG53904-NH
HSD17B10 cDNA ORF Clone, Mouse, C-HA tag MG53904-CY
HSD17B10 cDNA ORF Clone, Mouse, N-HA tag MG53904-NY
HSD17B10 cDNA ORF Clone, Mouse, C-Myc tag MG53904-CM
HSD17B10 cDNA ORF Clone, Mouse, N-Myc tag MG53904-NM

HSD17B10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSD17B10 cDNA ORF Clone in Cloning Vector, Human HG18266-U
HSD17B10 cDNA ORF Clone, Human, untagged HG18266-UT
HSD17B10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18266-ACGLN
HSD17B10 cDNA ORF Clone, Human, C-GFPSpark® tag HG18266-ACG
HSD17B10 cDNA ORF Clone, Human, N-GFPSpark® tag HG18266-ANG
HSD17B10 cDNA ORF Clone, Human, C-OFPSpark® tag HG18266-ACR
HSD17B10 cDNA ORF Clone, Human, N-OFPSpark® tag HG18266-ANR
HSD17B10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18266-CF
HSD17B10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18266-NF
HSD17B10 cDNA ORF Clone, Human, C-His tag HG18266-CH
HSD17B10 cDNA ORF Clone, Human, N-His tag HG18266-NH
HSD17B10 cDNA ORF Clone, Human, C-HA tag HG18266-CY
HSD17B10 cDNA ORF Clone, Human, N-HA tag HG18266-NY
HSD17B10 cDNA ORF Clone, Human, C-Myc tag HG18266-CM
HSD17B10 cDNA ORF Clone, Human, N-Myc tag HG18266-NM
info info
添加购物车成功! 添加购物车失败!