Hemopexin cDNA ORF Clone, Rat, untagged

Cat: RG81025-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Hemopexin Reagents

CRO Services

Product recommended


All Hemopexin Reagents

Hemopexin cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1383 bp
Description
Full length Clone DNA of Rat hemopexin.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hemopexin Background Information

Full Name
hemopexin

Hemopexin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Hemopexin cDNA ORF Clone in Cloning Vector, Rat RG81025-U
Hemopexin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81025-ACGLN
Hemopexin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81025-ACG
Hemopexin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81025-ACR
Hemopexin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81025-CF
Hemopexin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81025-NF
Hemopexin cDNA ORF Clone, Rat, C-His tag RG81025-CH
Hemopexin cDNA ORF Clone, Rat, N-His tag RG81025-NH
Hemopexin cDNA ORF Clone, Rat, C-HA tag RG81025-CY
Hemopexin cDNA ORF Clone, Rat, N-HA tag RG81025-NY
Hemopexin cDNA ORF Clone, Rat, C-Myc tag RG81025-CM
Hemopexin cDNA ORF Clone, Rat, N-Myc tag RG81025-NM
Hemopexin qPCR Primer Pairs, Rat RP300989

Hemopexin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Hemopexin cDNA ORF Clone in Cloning Vector, Mouse MG50271-M
Hemopexin cDNA ORF Clone, Mouse, untagged MG50271-UT
Hemopexin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50271-ACGLN
Hemopexin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50271-ACG
Hemopexin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50271-ACR
Hemopexin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50271-CF
Hemopexin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50271-NF
Hemopexin cDNA ORF Clone, Mouse, C-His tag MG50271-CH
Hemopexin cDNA ORF Clone, Mouse, N-His tag MG50271-NH
Hemopexin cDNA ORF Clone, Mouse, C-HA tag MG50271-CY
Hemopexin cDNA ORF Clone, Mouse, N-HA tag MG50271-NY
Hemopexin cDNA ORF Clone, Mouse, C-Myc tag MG50271-CM
Hemopexin cDNA ORF Clone, Mouse, N-Myc tag MG50271-NM
Hemopexin qPCR Primer Pairs, Mouse MP200080

Hemopexin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Hemopexin cDNA ORF Clone in Cloning Vector, Human HG10870-M
Hemopexin cDNA ORF Clone, Human, untagged HG10870-UT
Hemopexin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10870-ACGLN
Hemopexin cDNA ORF Clone, Human, C-GFPSpark® tag HG10870-ACG
Hemopexin cDNA ORF Clone, Human, C-OFPSpark® tag HG10870-ACR
Hemopexin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10870-CF
Hemopexin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10870-NF
Hemopexin cDNA ORF Clone, Human, C-His tag HG10870-CH
Hemopexin cDNA ORF Clone, Human, N-His tag HG10870-NH
Hemopexin cDNA ORF Clone, Human, C-HA tag HG10870-CY
Hemopexin cDNA ORF Clone, Human, N-HA tag HG10870-NY
Hemopexin cDNA ORF Clone, Human, C-Myc tag HG10870-CM
Hemopexin cDNA ORF Clone, Human, N-Myc tag HG10870-NM
Hemopexin qPCR Primer Pairs, Human HP100927
info info
添加购物车成功! 添加购物车失败!