HMGN2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG81006-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HMGN2 Reagents
CRO Services
Product recommended

All HMGN2 Reagents
HMGN2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
273 bp
Description
Full length Clone DNA of Rat high mobility group nucleosome binding domain 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGN2 Background Information
Full Name
high mobility group nucleosomal binding domain 2
Research Areas

HMGN2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HMGN2 cDNA ORF Clone in Cloning Vector, Rat RG81006-U
HMGN2 cDNA ORF Clone, Rat, untagged RG81006-UT
HMGN2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81006-ACG
HMGN2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81006-ACGLN
HMGN2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81006-ANG
HMGN2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81006-ACR
HMGN2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81006-ANR
HMGN2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81006-CF
HMGN2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81006-NF
HMGN2 cDNA ORF Clone, Rat, C-His tag RG81006-CH
HMGN2 cDNA ORF Clone, Rat, N-His tag RG81006-NH
HMGN2 cDNA ORF Clone, Rat, C-HA tag RG81006-CY
HMGN2 cDNA ORF Clone, Rat, N-HA tag RG81006-NY
HMGN2 cDNA ORF Clone, Rat, C-Myc tag RG81006-CM
HMGN2 qPCR Primer Pairs, Rat RP300970

HMGN2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMGN2 cDNA ORF Clone in Cloning Vector, Mouse MG52230-G
HMGN2 cDNA ORF Clone, Mouse, untagged MG52230-UT
HMGN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52230-ACG
HMGN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52230-ACGLN
HMGN2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52230-ANG
HMGN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52230-ACR
HMGN2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52230-ANR
HMGN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52230-CF
HMGN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52230-NF
HMGN2 cDNA ORF Clone, Mouse, C-His tag MG52230-CH
HMGN2 cDNA ORF Clone, Mouse, N-His tag MG52230-NH
HMGN2 cDNA ORF Clone, Mouse, C-HA tag MG52230-CY
HMGN2 cDNA ORF Clone, Mouse, N-HA tag MG52230-NY
HMGN2 cDNA ORF Clone, Mouse, C-Myc tag MG52230-CM
HMGN2 cDNA ORF Clone, Mouse, N-Myc tag MG52230-NM
HMGN2 qPCR Primer Pairs, Mouse MP202103

HMGN2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMGN2 cDNA ORF Clone in Cloning Vector, Human HG16545-U
HMGN2 cDNA ORF Clone, Human, untagged HG16545-UT
HMGN2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16545-ACG
HMGN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16545-ACGLN
HMGN2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16545-ANG
HMGN2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16545-ACR
HMGN2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16545-ANR
HMGN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16545-CF
HMGN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16545-NF
HMGN2 cDNA ORF Clone, Human, C-His tag HG16545-CH
HMGN2 cDNA ORF Clone, Human, N-His tag HG16545-NH
HMGN2 cDNA ORF Clone, Human, C-HA tag HG16545-CY
HMGN2 cDNA ORF Clone, Human, N-HA tag HG16545-NY
HMGN2 cDNA ORF Clone, Human, C-Myc tag HG16545-CM
HMGN2 cDNA ORF Clone, Human, N-Myc tag HG16545-NM
info info
添加购物车成功! 添加购物车失败!