HMGCS2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80898-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HMGCS2 Reagents
CRO Services
Product recommended

All HMGCS2 Reagents
HMGCS2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1527 bp
Description
Full length Clone DNA of Rat 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGCS2 Background Information
Full Name
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)

HMGCS2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HMGCS2 cDNA ORF Clone in Cloning Vector, Rat RG80898-U
HMGCS2 cDNA ORF Clone, Rat, untagged RG80898-UT
HMGCS2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80898-ACG
HMGCS2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80898-ACGLN
HMGCS2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80898-ANG
HMGCS2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80898-ACR
HMGCS2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80898-ANR
HMGCS2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80898-CF
HMGCS2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80898-NF
HMGCS2 cDNA ORF Clone, Rat, C-His tag RG80898-CH
HMGCS2 cDNA ORF Clone, Rat, N-His tag RG80898-NH
HMGCS2 cDNA ORF Clone, Rat, C-HA tag RG80898-CY
HMGCS2 cDNA ORF Clone, Rat, N-HA tag RG80898-NY
HMGCS2 cDNA ORF Clone, Rat, C-Myc tag RG80898-CM
HMGCS2 qPCR Primer Pairs, Rat RP300862

HMGCS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMGCS2 cDNA ORF Clone in Cloning Vector, Mouse MG53184-G
HMGCS2 cDNA ORF Clone, Mouse, untagged MG53184-UT
HMGCS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53184-ACG
HMGCS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53184-ACGLN
HMGCS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53184-ANG
HMGCS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53184-ACR
HMGCS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53184-ANR
HMGCS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53184-CF
HMGCS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53184-NF
HMGCS2 cDNA ORF Clone, Mouse, C-His tag MG53184-CH
HMGCS2 cDNA ORF Clone, Mouse, N-His tag MG53184-NH
HMGCS2 cDNA ORF Clone, Mouse, C-HA tag MG53184-CY
HMGCS2 cDNA ORF Clone, Mouse, N-HA tag MG53184-NY
HMGCS2 cDNA ORF Clone, Mouse, C-Myc tag MG53184-CM
HMGCS2 cDNA ORF Clone, Mouse, N-Myc tag MG53184-NM

HMGCS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMGCS2 cDNA ORF Clone in Cloning Vector, Human HG19968-U
HMGCS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19968-ACGLN
info info
添加购物车成功! 添加购物车失败!