HMG4 cDNA ORF Clone, Rat, N-His tag

Cat: RG80527-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HMG4 Reagents
CRO Services
Product recommended

All HMG4 Reagents
HMG4 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Rat high mobility group box 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMG4 Background Information
Full Name
high mobility group box 3

HMG4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HMG4 cDNA ORF Clone in Cloning Vector, Rat RG80527-U
HMG4 cDNA ORF Clone, Rat, untagged RG80527-UT
HMG4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80527-ACG
HMG4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80527-ACGLN
HMG4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80527-ANG
HMG4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80527-ACR
HMG4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80527-ANR
HMG4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80527-CF
HMG4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80527-NF
HMG4 cDNA ORF Clone, Rat, C-His tag RG80527-CH
HMG4 cDNA ORF Clone, Rat, C-HA tag RG80527-CY
HMG4 cDNA ORF Clone, Rat, N-HA tag RG80527-NY
HMG4 cDNA ORF Clone, Rat, C-Myc tag RG80527-CM
HMG4 cDNA ORF Clone, Rat, N-Myc tag RG80527-NM
HMG4 qPCR Primer Pairs, Rat RP300491

HMG4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMG4 cDNA ORF Clone in Cloning Vector, Mouse MG51744-U
HMG4 cDNA ORF Clone, Mouse, untagged MG51744-UT
HMG4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51744-ACGLN
HMG4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51744-ACG
HMG4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51744-ANG
HMG4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51744-ACR
HMG4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51744-ANR
HMG4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51744-CF
HMG4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51744-NF
HMG4 cDNA ORF Clone, Mouse, C-His tag MG51744-CH
HMG4 cDNA ORF Clone, Mouse, N-His tag MG51744-NH
HMG4 cDNA ORF Clone, Mouse, C-HA tag MG51744-CY
HMG4 cDNA ORF Clone, Mouse, N-HA tag MG51744-NY
HMG4 cDNA ORF Clone, Mouse, C-Myc tag MG51744-CM
HMG4 cDNA ORF Clone, Mouse, N-Myc tag MG51744-NM
HMG4 qPCR Primer Pairs, Mouse MP201617

HMG4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMG4 cDNA ORF Clone in Cloning Vector, Human HG11154-M
HMG4 cDNA ORF Clone, Human, untagged HG11154-UT
HMG4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11154-ACGLN
HMG4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11154-ACG
HMG4 cDNA ORF Clone, Human, N-GFPSpark® tag HG11154-ANG
HMG4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11154-ACR
HMG4 cDNA ORF Clone, Human, N-OFPSpark® tag HG11154-ANR
HMG4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11154-CF
HMG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11154-NF
HMG4 cDNA ORF Clone, Human, C-His tag HG11154-CH
HMG4 cDNA ORF Clone, Human, N-His tag HG11154-NH
HMG4 cDNA ORF Clone, Human, C-HA tag HG11154-CY
HMG4 cDNA ORF Clone, Human, N-HA tag HG11154-NY
HMG4 cDNA ORF Clone, Human, C-Myc tag HG11154-CM
HMG4 cDNA ORF Clone, Human, N-Myc tag HG11154-NM
HMG4 qPCR Primer Pairs, Human HP101063
info info
添加购物车成功! 添加购物车失败!