GPT2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80002-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPT2 Reagents
CRO Services
Product recommended

All GPT2 Reagents
GPT2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1569 bp
Description
Full length Clone DNA of Rat glutamic pyruvate transaminase (alanine aminotransferase) 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPT2 Background Information

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (Gpt), is a pyridoxal enzyme which catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. Gpt1 is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level, whereas Gpt2 expression is more restricted, mainly in liver, muscle, brain, and white adipose tissue. It has been reported that hepatic ALT2 protein is approximately four times higher in male rats than in female rats.

Full Name
glutamic pyruvate transaminase (alanine aminotransferase) 2
References
  • Matthews, C.C. et al., 2002, Genomics. 79: 445-450.
  • Jadhao, S.B. et al., 2004, Hepatology. 39: 1297-1302.
  • Schindhelm, R.K. et al., 2005, Eur. J.Clin. Invest. 35:369-374.
  • Lindblom, P. et al., 2007, Arch Biochem Biophys. 466 (1): 66-77.
  • Liu, L.et al., 2008, Protein Expr Purif. 60 (2): 225-231.
  • Yang, R. Z. et al., 2009, Hepatology. 49 (2): 598-607.
  • GPT2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GPT2 cDNA ORF Clone in Cloning Vector, Rat RG80002-M
    GPT2 cDNA ORF Clone, Rat, untagged RG80002-UT
    GPT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80002-ACGLN
    GPT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80002-ACG
    GPT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80002-ANG
    GPT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80002-ACR
    GPT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80002-ANR
    GPT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80002-CF
    GPT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80002-NF
    GPT2 cDNA ORF Clone, Rat, C-His tag RG80002-CH
    GPT2 cDNA ORF Clone, Rat, N-His tag RG80002-NH
    GPT2 cDNA ORF Clone, Rat, C-HA tag RG80002-CY
    GPT2 cDNA ORF Clone, Rat, N-HA tag RG80002-NY
    GPT2 cDNA ORF Clone, Rat, N-Myc tag RG80002-NM
    GPT2 qPCR Primer Pairs, Rat RP300002

    GPT2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GPT2 cDNA ORF Clone in Cloning Vector, Human HG22770-U
    GPT2 cDNA ORF Clone, Human, untagged HG22770-UT
    GPT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG22770-ACG
    GPT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22770-ACGLN
    GPT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG22770-ANG
    GPT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG22770-ACR
    GPT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG22770-ANR
    GPT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22770-CF
    GPT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22770-NF
    GPT2 cDNA ORF Clone, Human, C-His tag HG22770-CH
    GPT2 cDNA ORF Clone, Human, N-His tag HG22770-NH
    GPT2 cDNA ORF Clone, Human, C-HA tag HG22770-CY
    GPT2 cDNA ORF Clone, Human, N-HA tag HG22770-NY
    GPT2 cDNA ORF Clone, Human, C-Myc tag HG22770-CM
    GPT2 cDNA ORF Clone, Human, N-Myc tag HG22770-NM
    info info
    添加购物车成功! 添加购物车失败!