GSTM2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80757-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GSTM2 Reagents
CRO Services
Product recommended

All GSTM2 Reagents
GSTM2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Rat glutathione S-transferase mu 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTM2 Background Information

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

Full Name
glutathione S-transferase mu 2 (muscle)
References
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • GSTM2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GSTM2 cDNA ORF Clone in Cloning Vector, Rat RG80757-U
    GSTM2 cDNA ORF Clone, Rat, untagged RG80757-UT
    GSTM2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80757-ACG
    GSTM2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80757-ACGLN
    GSTM2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80757-ANG
    GSTM2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80757-ACR
    GSTM2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80757-ANR
    GSTM2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80757-CF
    GSTM2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80757-NF
    GSTM2 cDNA ORF Clone, Rat, C-His tag RG80757-CH
    GSTM2 cDNA ORF Clone, Rat, N-His tag RG80757-NH
    GSTM2 cDNA ORF Clone, Rat, C-HA tag RG80757-CY
    GSTM2 cDNA ORF Clone, Rat, N-HA tag RG80757-NY
    GSTM2 cDNA ORF Clone, Rat, C-Myc tag RG80757-CM
    GSTM2 qPCR Primer Pairs, Rat RP300721

    GSTM2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GSTM2 cDNA ORF Clone in Cloning Vector, Mouse MG52883-G
    GSTM2 cDNA ORF Clone, Mouse, untagged MG52883-UT
    GSTM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52883-ACG
    GSTM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52883-ACGLN
    GSTM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52883-ANG
    GSTM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52883-ACR
    GSTM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52883-ANR
    GSTM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52883-CF
    GSTM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52883-NF
    GSTM2 cDNA ORF Clone, Mouse, C-His tag MG52883-CH
    GSTM2 cDNA ORF Clone, Mouse, N-His tag MG52883-NH
    GSTM2 cDNA ORF Clone, Mouse, C-HA tag MG52883-CY
    GSTM2 cDNA ORF Clone, Mouse, N-HA tag MG52883-NY
    GSTM2 cDNA ORF Clone, Mouse, C-Myc tag MG52883-CM
    GSTM2 cDNA ORF Clone, Mouse, N-Myc tag MG52883-NM

    GSTM2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GSTM2 cDNA ORF Clone in Cloning Vector, Human HG12042-G
    GSTM2 cDNA ORF Clone, Human, untagged HG12042-UT
    GSTM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12042-ACGLN
    GSTM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12042-ACG
    GSTM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12042-ANG
    GSTM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12042-ACR
    GSTM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12042-ANR
    GSTM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12042-CF
    GSTM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12042-NF
    GSTM2 cDNA ORF Clone, Human, C-His tag HG12042-CH
    GSTM2 cDNA ORF Clone, Human, N-His tag HG12042-NH
    GSTM2 cDNA ORF Clone, Human, C-HA tag HG12042-CY
    GSTM2 cDNA ORF Clone, Human, N-HA tag HG12042-NY
    GSTM2 cDNA ORF Clone, Human, C-Myc tag HG12042-CM
    GSTM2 cDNA ORF Clone, Human, N-Myc tag HG12042-NM
    GSTM2 qPCR Primer Pairs, Human HP101576
    info info
    添加购物车成功! 添加购物车失败!