GRINA cDNA ORF Clone, Rat, C-His tag

Cat: RG81114-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GRINA Reagents
CRO Services
Product recommended

All GRINA Reagents
GRINA cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Rat glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRINA Background Information
Full Name
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)

GRINA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GRINA cDNA ORF Clone in Cloning Vector, Rat RG81114-U
GRINA cDNA ORF Clone, Rat, untagged RG81114-UT
GRINA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81114-ACGLN
GRINA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81114-ACG
GRINA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81114-ACR
GRINA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81114-CF
GRINA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81114-NF
GRINA cDNA ORF Clone, Rat, N-His tag RG81114-NH
GRINA cDNA ORF Clone, Rat, C-HA tag RG81114-CY
GRINA cDNA ORF Clone, Rat, N-HA tag RG81114-NY
GRINA cDNA ORF Clone, Rat, C-Myc tag RG81114-CM
GRINA cDNA ORF Clone, Rat, N-Myc tag RG81114-NM
GRINA qPCR Primer Pairs, Rat RP301071

GRINA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRINA cDNA ORF Clone in Cloning Vector, Mouse MG51673-U
GRINA cDNA ORF Clone, Mouse, untagged MG51673-UT
GRINA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51673-ACGLN
GRINA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51673-ACG
GRINA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51673-ANG
GRINA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51673-ACR
GRINA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51673-ANR
GRINA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51673-CF
GRINA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51673-NF
GRINA cDNA ORF Clone, Mouse, C-His tag MG51673-CH
GRINA cDNA ORF Clone, Mouse, N-His tag MG51673-NH
GRINA cDNA ORF Clone, Mouse, C-HA tag MG51673-CY
GRINA cDNA ORF Clone, Mouse, N-HA tag MG51673-NY
GRINA cDNA ORF Clone, Mouse, C-Myc tag MG51673-CM
GRINA cDNA ORF Clone, Mouse, N-Myc tag MG51673-NM
GRINA qPCR Primer Pairs, Mouse MP201546

GRINA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRINA cDNA ORF Clone in Cloning Vector, Human HG20045-U
info info
添加购物车成功! 添加购物车失败!