GPX1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81302-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPX1 Reagents
CRO Services
Product recommended

All GPX1 Reagents
GPX1 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Rat glutathione peroxidase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPX1 Background Information
Full Name
glutathione peroxidase 1

GPX1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
GPX1 cDNA ORF Clone in Cloning Vector, Ferret FG60066-G
GPX1 cDNA ORF Clone, Ferret, untagged FG60066-UT
GPX1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60066-ACGLN
GPX1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60066-ACG
GPX1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60066-ANG
GPX1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60066-ACR
GPX1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60066-ANR
GPX1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60066-CF
GPX1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60066-NF
GPX1 cDNA ORF Clone, Ferret, C-His tag FG60066-CH
GPX1 cDNA ORF Clone, Ferret, N-His tag FG60066-NH
GPX1 cDNA ORF Clone, Ferret, C-HA tag FG60066-CY
GPX1 cDNA ORF Clone, Ferret, N-HA tag FG60066-NY
GPX1 cDNA ORF Clone, Ferret, C-Myc tag FG60066-CM
GPX1 cDNA ORF Clone, Ferret, N-Myc tag FG60066-NM

GPX1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GPX1 cDNA ORF Clone in Cloning Vector, Rat RG81302-U
GPX1 cDNA ORF Clone, Rat, untagged RG81302-UT
GPX1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81302-ACGLN
GPX1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81302-ACG
GPX1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81302-ANG
GPX1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81302-ACR
GPX1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81302-ANR
GPX1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81302-CF
GPX1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81302-NF
GPX1 cDNA ORF Clone, Rat, C-His tag RG81302-CH
GPX1 cDNA ORF Clone, Rat, N-His tag RG81302-NH
GPX1 cDNA ORF Clone, Rat, C-HA tag RG81302-CY
GPX1 cDNA ORF Clone, Rat, N-HA tag RG81302-NY
GPX1 cDNA ORF Clone, Rat, N-Myc tag RG81302-NM
GPX1 qPCR Primer Pairs, Rat RP301258

GPX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GPX1 cDNA ORF Clone in Cloning Vector, Mouse MG53157-G
GPX1 cDNA ORF Clone, Mouse, untagged MG53157-UT
GPX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53157-ACGLN
GPX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53157-ACG
GPX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53157-ANG
GPX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53157-ACR
GPX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53157-ANR
GPX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53157-CF
GPX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53157-NF
GPX1 cDNA ORF Clone, Mouse, C-His tag MG53157-CH
GPX1 cDNA ORF Clone, Mouse, N-His tag MG53157-NH
GPX1 cDNA ORF Clone, Mouse, C-HA tag MG53157-CY
GPX1 cDNA ORF Clone, Mouse, N-HA tag MG53157-NY
GPX1 cDNA ORF Clone, Mouse, C-Myc tag MG53157-CM
GPX1 cDNA ORF Clone, Mouse, N-Myc tag MG53157-NM

GPX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPX1 cDNA ORF Clone in Cloning Vector, Human HG16646-U
GPX1 cDNA ORF Clone, Human, untagged HG16646-UT
GPX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16646-ACG
GPX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16646-ACGLN
GPX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16646-ANG
GPX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16646-ACR
GPX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16646-ANR
GPX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16646-CF
GPX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16646-NF
GPX1 cDNA ORF Clone, Human, C-His tag HG16646-CH
GPX1 cDNA ORF Clone, Human, N-His tag HG16646-NH
GPX1 cDNA ORF Clone, Human, C-HA tag HG16646-CY
GPX1 cDNA ORF Clone, Human, N-HA tag HG16646-NY
GPX1 cDNA ORF Clone, Human, C-Myc tag HG16646-CM
GPX1 cDNA ORF Clone, Human, N-Myc tag HG16646-NM
info info
添加购物车成功! 添加购物车失败!