GLRX3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81629-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GLRX3 Reagents
CRO Services
Product recommended

All GLRX3 Reagents
GLRX3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Rat glutaredoxin 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GLRX3 Background Information
Full Name
glutaredoxin 3

GLRX3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GLRX3 cDNA ORF Clone in Cloning Vector, Rat RG81629-G
GLRX3 cDNA ORF Clone, Rat, untagged RG81629-UT
GLRX3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81629-ACGLN
GLRX3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81629-ACG
GLRX3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81629-ANG
GLRX3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81629-ACR
GLRX3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81629-ANR
GLRX3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81629-CF
GLRX3 cDNA ORF Clone, Rat, C-His tag RG81629-CH
GLRX3 cDNA ORF Clone, Rat, N-His tag RG81629-NH
GLRX3 cDNA ORF Clone, Rat, C-HA tag RG81629-CY
GLRX3 cDNA ORF Clone, Rat, N-HA tag RG81629-NY
GLRX3 cDNA ORF Clone, Rat, C-Myc tag RG81629-CM
GLRX3 cDNA ORF Clone, Rat, N-Myc tag RG81629-NM

GLRX3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GLRX3 cDNA ORF Clone in Cloning Vector, Mouse MG53435-U
GLRX3 cDNA ORF Clone, Mouse, untagged MG53435-UT
GLRX3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53435-ACG
GLRX3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53435-ACGLN
GLRX3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53435-ANG
GLRX3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53435-ACR
GLRX3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53435-ANR
GLRX3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53435-CF
GLRX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53435-NF
GLRX3 cDNA ORF Clone, Mouse, C-His tag MG53435-CH
GLRX3 cDNA ORF Clone, Mouse, N-His tag MG53435-NH
GLRX3 cDNA ORF Clone, Mouse, C-HA tag MG53435-CY
GLRX3 cDNA ORF Clone, Mouse, N-HA tag MG53435-NY
GLRX3 cDNA ORF Clone, Mouse, C-Myc tag MG53435-CM
GLRX3 cDNA ORF Clone, Mouse, N-Myc tag MG53435-NM

GLRX3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GLRX3 cDNA ORF Clone in Cloning Vector, Human HG16435-G
GLRX3 cDNA ORF Clone, Human, untagged HG16435-UT
GLRX3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16435-ACG
GLRX3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16435-ACGLN
GLRX3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16435-ANG
GLRX3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16435-ACR
GLRX3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16435-ANR
GLRX3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16435-CF
GLRX3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16435-NF
GLRX3 cDNA ORF Clone, Human, C-His tag HG16435-CH
GLRX3 cDNA ORF Clone, Human, N-His tag HG16435-NH
GLRX3 cDNA ORF Clone, Human, C-HA tag HG16435-CY
GLRX3 cDNA ORF Clone, Human, N-HA tag HG16435-NY
GLRX3 cDNA ORF Clone, Human, C-Myc tag HG16435-CM
GLRX3 cDNA ORF Clone, Human, N-Myc tag HG16435-NM
GLRX3 qPCR Primer Pairs, Human HP105183
info info
添加购物车成功! 添加购物车失败!