After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat Growth Hormone Receptor / GHR / GHBP Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat GHR cDNA Clone Product Information
NCBI RefSeq:NM_017094.1
RefSeq ORF Size:1917bp
cDNA Description:Full length Clone DNA of Rattus norvegicus growth hormone receptor with C terminal Myc tag.
Gene Synonym:GHR/BP, MGC124963, MGC156665, Ghr
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Growth hormone receptor, also known as GH receptor and GHR, is a single-pass type I  membrane protein which belongs to the type I  cytokine receptor family and type 1 subfamily. GHR contains one fibronectin type-III domain. Growth hormone receptor / GHR is expressed in various tissues with high expression in liver and skeletal muscle. Isoform 4 of GHR is predominantly expressed in kidney, bladder, adrenal gland and brain stem. Isoform 1 expression of GHR in placenta is predominant in chorion and decidua. Isoform 4 is highly expressed in placental villi. Isoform 2 of GHR is expressed in lung, stomach and muscle. Growth hormone receptor / GHR is a receptor for pituitary gland growth hormone. It is involved in regulating postnatal body growth. On ligand binding, it couples to the JAK2 / STAT5 pathway. Isoform 2 of GHR up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. Defects in GHR are a cause of Laron syndrome (LARS) which is a severe form of growth hormone insensitivity characterized by growth impairment, short stature, dysfunctional growth hormone receptor, and failure to generate insulin-like growth factor I in response to growth hormone. Defects in GHR may also be a cause of idiopathic short stature autosomal (ISSA) which is defined by a subnormal rate of growth.

References
  • Leung DW. et al., 1987, Nature. 330:537-43.
  • Sobrier M-L. et al., 1997, J Clin Endocrinol Metab. 82: 435-7.
  • Enberg B. et al., 2000, Eur J Endocrinol. 143: 71-6.
  • Pantel J. et al., 2000, J Biol Chem. 275: 18664-9.
  • Jorge AAL. et al., 2004, Clin Endocrinol. (Oxf.) 60: 36-40.
  • Size / Price
    Catalog: RG80029-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"