Quick Order

Text Size:AAA

Rat Growth Hormone Receptor / GHR / GHBP Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat GHR cDNA Clone Product Information
NCBI RefSeq:NM_017094.1
RefSeq ORF Size:1917bp
cDNA Description:Full length Clone DNA of Rattus norvegicus growth hormone receptor with C terminal Flag tag.
Gene Synonym:GHR/BP, MGC124963, MGC156665, Ghr
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Growth hormone receptor, also known as GH receptor and GHR, is a single-pass type I  membrane protein which belongs to the type I  cytokine receptor family and type 1 subfamily. GHR contains one fibronectin type-III domain. Growth hormone receptor / GHR is expressed in various tissues with high expression in liver and skeletal muscle. Isoform 4 of GHR is predominantly expressed in kidney, bladder, adrenal gland and brain stem. Isoform 1 expression of GHR in placenta is predominant in chorion and decidua. Isoform 4 is highly expressed in placental villi. Isoform 2 of GHR is expressed in lung, stomach and muscle. Growth hormone receptor / GHR is a receptor for pituitary gland growth hormone. It is involved in regulating postnatal body growth. On ligand binding, it couples to the JAK2 / STAT5 pathway. Isoform 2 of GHR up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. Defects in GHR are a cause of Laron syndrome (LARS) which is a severe form of growth hormone insensitivity characterized by growth impairment, short stature, dysfunctional growth hormone receptor, and failure to generate insulin-like growth factor I in response to growth hormone. Defects in GHR may also be a cause of idiopathic short stature autosomal (ISSA) which is defined by a subnormal rate of growth.

References
  • Leung DW. et al., 1987, Nature. 330:537-43.
  • Sobrier M-L. et al., 1997, J Clin Endocrinol Metab. 82: 435-7.
  • Enberg B. et al., 2000, Eur J Endocrinol. 143: 71-6.
  • Pantel J. et al., 2000, J Biol Chem. 275: 18664-9.
  • Jorge AAL. et al., 2004, Clin Endocrinol. (Oxf.) 60: 36-40.
  • Size / Price
    Catalog: RG80029-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"