GGT1 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80364-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GGT1 Reagents
CRO Services
Product recommended

All GGT1 Reagents
GGT1 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1707 bp
Description
Full length Clone DNA of Rat gamma-glutamyltransferase 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GGT1 Background Information

GGT1 belongs to the gamma-glutamyltransferase protein family. Many members of this family have not yet been fully characterized and some of which may represent pseudogenes. GGT1 is composed of a heavy chain and a light chain. It catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. GGT1 also initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracelular GSH level. As part of the cell antioxidant defense mechanism, GGT1 can be detected in fetal and adult kidney and liver, adult pancreas, stomach, intestine, placenta and lung. Defects in GGT1 can cause glutathionuria which is known as an autosomal recessive disease.

Full Name
gamma-glutamyltransferase 1
References
  • Bulle F, et al. (1987) Assignment of the human gamma-glutamyl transferase gene to the long arm of chromosome 22. Hum Genet. 76(3):283-6.
  • Tate SS, et al. (1988) Renal gamma-glutamyl transpeptidases: structural and immunological studies. Arch Biochem Biophys. 262(2):397-408.
  • Tate SS, et al. (1988) In vitro translation and processing of human hepatoma cell (Hep G2) gamma-glutamyl transpeptidase. Biochem Biophys Res Commun. 154(3):1167-73.
  • GGT1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GGT1 cDNA ORF Clone in Cloning Vector, Rat RG80364-G
    GGT1 cDNA ORF Clone, Rat, untagged RG80364-UT
    GGT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80364-ACGLN
    GGT1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80364-ACG
    GGT1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80364-ACR
    GGT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80364-CF
    GGT1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80364-NF
    GGT1 cDNA ORF Clone, Rat, C-His tag RG80364-CH
    GGT1 cDNA ORF Clone, Rat, N-His tag RG80364-NH
    GGT1 cDNA ORF Clone, Rat, N-HA tag RG80364-NY
    GGT1 cDNA ORF Clone, Rat, C-Myc tag RG80364-CM
    GGT1 cDNA ORF Clone, Rat, N-Myc tag RG80364-NM
    GGT1 qPCR Primer Pairs, Rat RP300334

    GGT1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GGT1 cDNA ORF Clone in Cloning Vector, Mouse MG50875-G
    GGT1 cDNA ORF Clone, Mouse, untagged MG50875-UT
    GGT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50875-ACGLN
    GGT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50875-ACG
    GGT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50875-ACR
    GGT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50875-CF
    GGT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50875-NF
    GGT1 cDNA ORF Clone, Mouse, C-His tag MG50875-CH
    GGT1 cDNA ORF Clone, Mouse, N-His tag MG50875-NH
    GGT1 cDNA ORF Clone, Mouse, C-HA tag MG50875-CY
    GGT1 cDNA ORF Clone, Mouse, N-HA tag MG50875-NY
    GGT1 cDNA ORF Clone, Mouse, C-Myc tag MG50875-CM
    GGT1 cDNA ORF Clone, Mouse, N-Myc tag MG50875-NM
    GGT1 qPCR Primer Pairs, Mouse MP200846

    GGT1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GGT1 cDNA ORF Clone, Human, untagged HG17659-UT
    info info
    添加购物车成功! 添加购物车失败!