GDNF cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80050-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GDNF Reagents
CRO Services
Product recommended

All GDNF Reagents
GDNF cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
636 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat glial cell derived neurotrophic factor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.68kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GDNF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDNF cDNA ORF Clone, Rat, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
GDNF Background Information

Glial cell line-derived neurotrophic factor(GDNF) is an important member of the GDNF family of ligands(GFL). The GDNF family of ligands is comprised by four neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), artemin (ARTN), and persephin (PSPN). It has been found that GFLs play a role in a number of biological processes including cell survival, neurite outgrowth, cell differentiation and cell migration. As the founding member, GDNF plays a key role in the promotion of the survival of dopaminergic neurons. GDNF is a highly conserved neurotrophic factor. The recombinant form of this protein also promotes the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. GDNF also regulates kidney development and spermatogenesis, and it affects alcohol consumption. It has been shown that GDNF results in two Parkinson's disease clinical trial and in a number of animal trials. It has been taken as a potent survival factor for central motoneurons.

Full Name
glial cell derived neurotrophic factor
References
  • Oppenheim RW, et al. (1995) Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF. Nature. 373 (6512): 344-6.
  • Tomac A, et al. (1995) Protection and repair of the nigrostriatal dopaminergic system by GDNF in vivo. Nature. 373 (6512): 335-9.
  • Schindelhauer D, et al. (1996) The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1. Genomics. 28 (3): 605-7.
  • Carnicella S, et al. (2008) GDNF is a fast-acting potent inhibitor of alcohol consumption and relapse. Proc Natl Acad Sci . 105 (23): 8114-9.
  • info info
    添加购物车成功! 添加购物车失败!