GDI2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80848-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GDI2 Reagents
CRO Services
Product recommended

All GDI2 Reagents
GDI2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Rat GDP dissociation inhibitor 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDI2 Background Information
Full Name
GDP dissociation inhibitor 2

GDI2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GDI2 cDNA ORF Clone in Cloning Vector, Rat RG80848-U
GDI2 cDNA ORF Clone, Rat, untagged RG80848-UT
GDI2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80848-ACG
GDI2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80848-ACGLN
GDI2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80848-ANG
GDI2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80848-ACR
GDI2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80848-ANR
GDI2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80848-CF
GDI2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80848-NF
GDI2 cDNA ORF Clone, Rat, C-His tag RG80848-CH
GDI2 cDNA ORF Clone, Rat, N-His tag RG80848-NH
GDI2 cDNA ORF Clone, Rat, C-HA tag RG80848-CY
GDI2 cDNA ORF Clone, Rat, N-HA tag RG80848-NY
GDI2 cDNA ORF Clone, Rat, C-Myc tag RG80848-CM
GDI2 qPCR Primer Pairs, Rat RP300812

GDI2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GDI2 cDNA ORF Clone in Cloning Vector, Mouse MG53640-U
GDI2 cDNA ORF Clone, Mouse, untagged MG53640-UT
GDI2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53640-ACG
GDI2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53640-ACGLN
GDI2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53640-ANG
GDI2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53640-ACR
GDI2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53640-ANR
GDI2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53640-CF
GDI2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53640-NF
GDI2 cDNA ORF Clone, Mouse, C-His tag MG53640-CH
GDI2 cDNA ORF Clone, Mouse, N-His tag MG53640-NH
GDI2 cDNA ORF Clone, Mouse, C-HA tag MG53640-CY
GDI2 cDNA ORF Clone, Mouse, N-HA tag MG53640-NY
GDI2 cDNA ORF Clone, Mouse, C-Myc tag MG53640-CM
GDI2 cDNA ORF Clone, Mouse, N-Myc tag MG53640-NM

GDI2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDI2 cDNA ORF Clone in Cloning Vector, Human HG12380-U
GDI2 cDNA ORF Clone, Human, untagged HG12380-G-N
GDI2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12380-ACGLN
GDI2 qPCR Primer Pairs, Human HP104740
info info
添加购物车成功! 添加购物车失败!