FTO cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80935-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FTO Reagents
CRO Services
Product recommended

All FTO Reagents
FTO cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1509 bp
Description
Full length Clone DNA of Rat fat mass and obesity associated with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTO Background Information
Full Name
fat mass and obesity associated

FTO cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Rat RG80935-U
FTO cDNA ORF Clone, Rat, untagged RG80935-UT
FTO cDNA ORF Clone, Rat, C-GFPSpark® tag RG80935-ACG
FTO Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80935-ACGLN
FTO cDNA ORF Clone, Rat, N-GFPSpark® tag RG80935-ANG
FTO cDNA ORF Clone, Rat, C-OFPSpark® tag RG80935-ACR
FTO cDNA ORF Clone, Rat, N-OFPSpark® tag RG80935-ANR
FTO cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80935-CF
FTO cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80935-NF
FTO cDNA ORF Clone, Rat, C-His tag RG80935-CH
FTO cDNA ORF Clone, Rat, N-His tag RG80935-NH
FTO cDNA ORF Clone, Rat, C-HA tag RG80935-CY
FTO cDNA ORF Clone, Rat, N-HA tag RG80935-NY
FTO cDNA ORF Clone, Rat, C-Myc tag RG80935-CM
FTO qPCR Primer Pairs, Rat RP300899

FTO cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Mouse MG53159-G
FTO cDNA ORF Clone, Mouse, untagged MG53159-UT
FTO cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53159-ACG
FTO Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53159-ACGLN
FTO cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53159-ANG
FTO cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53159-ACR
FTO cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53159-ANR
FTO cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53159-CF
FTO cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53159-NF
FTO cDNA ORF Clone, Mouse, C-His tag MG53159-CH
FTO cDNA ORF Clone, Mouse, N-His tag MG53159-NH
FTO cDNA ORF Clone, Mouse, C-HA tag MG53159-CY
FTO cDNA ORF Clone, Mouse, N-HA tag MG53159-NY
FTO cDNA ORF Clone, Mouse, C-Myc tag MG53159-CM
FTO cDNA ORF Clone, Mouse, N-Myc tag MG53159-NM

FTO cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Human HG12125-G
FTO cDNA ORF Clone, Human, untagged HG12125-UT
FTO cDNA ORF Clone, Human, C-GFPSpark® tag HG12125-ACG
FTO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12125-ACGLN
FTO cDNA ORF Clone, Human, N-GFPSpark® tag HG12125-ANG
FTO cDNA ORF Clone, Human, C-OFPSpark® tag HG12125-ACR
FTO cDNA ORF Clone, Human, N-OFPSpark® tag HG12125-ANR
FTO cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12125-CF
FTO cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12125-NF
FTO cDNA ORF Clone, Human, C-His tag HG12125-CH
FTO cDNA ORF Clone, Human, N-His tag HG12125-NH
FTO cDNA ORF Clone, Human, C-HA tag HG12125-CY
FTO cDNA ORF Clone, Human, N-HA tag HG12125-NY
FTO cDNA ORF Clone, Human, C-Myc tag HG12125-CM
FTO cDNA ORF Clone, Human, N-Myc tag HG12125-NM
FTO qPCR Primer Pairs, Human HP101651
info info
添加购物车成功! 添加购物车失败!