VEGFD cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80104-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VEGFD Reagents
CRO Services
Product recommended

All VEGFD Reagents
VEGFD cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Rat c-fos induced growth factor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VEGFD Background Information

Vascular endothelial growth factor D (VEGF-D), also known as C-fos induced growth factor (FIGF), belongs to the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. FIGF protein is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. FIGF protein is secreted as a non-covelent homodimer in an antiparallel fashion. Human FIGF protein is expressed in adult lung, heart, muscle, and small intestine, and is most abundantly expressed in fetal lungs and skin. FIGF protein is structurally and functionally similar to VEGF-C. Therefore, FIGF protein binds and activates VEGFR-2 (Flk1) and VEGFR-3 (Flt4) receptors, and may particularly be involved in cancers, such as breast cancer, epithelial ovarian carcinoma and so on.

Full Name
c-fos induced growth factor (vascular endothelial growth factor D)
References
  • Avantaggiato V, et al. (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family. Mech Dev. 73(2):221-4.
  • Rocchigiani M, et al. (1998) Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes. Genomics 47(2):207-16.
  • Karpanen T, et al. (2008) VEGF-D: a modifier of embryonic lymphangiogenesis. Blood. 112(5): 1547-8.
  • VEGFD cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VEGFD cDNA ORF Clone in Cloning Vector, Rat RG80104-G
    VEGFD cDNA ORF Clone, Rat, untagged RG80104-UT
    VEGFD cDNA ORF Clone, Rat, C-GFPSpark® tag RG80104-ACG
    VEGFD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80104-ACGLN
    VEGFD cDNA ORF Clone, Rat, C-OFPSpark® tag RG80104-ACR
    VEGFD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80104-CF
    VEGFD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80104-NF
    VEGFD cDNA ORF Clone, Rat, C-His tag RG80104-CH
    VEGFD cDNA ORF Clone, Rat, N-His tag RG80104-NH
    VEGFD cDNA ORF Clone, Rat, C-HA tag RG80104-CY
    VEGFD cDNA ORF Clone, Rat, N-HA tag RG80104-NY
    VEGFD cDNA ORF Clone, Rat, N-Myc tag RG80104-NM
    VEGFD qPCR Primer Pairs, Rat RP300099

    VEGFD cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VEGFD cDNA ORF Clone in Cloning Vector, Mouse MG50157-M
    VEGFD cDNA ORF Clone, Mouse, untagged MG50157-UT
    VEGFD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50157-ACG
    VEGFD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50157-ACGLN
    VEGFD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50157-ACR
    VEGFD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50157-CF
    VEGFD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50157-NF
    VEGFD cDNA ORF Clone, Mouse, C-His tag MG50157-CH
    VEGFD cDNA ORF Clone, Mouse, N-His tag MG50157-NH
    VEGFD cDNA ORF Clone, Mouse, C-HA tag MG50157-CY
    VEGFD cDNA ORF Clone, Mouse, N-HA tag MG50157-NY
    VEGFD cDNA ORF Clone, Mouse, C-Myc tag MG50157-CM
    VEGFD cDNA ORF Clone, Mouse, N-Myc tag MG50157-NM
    VEGFD qPCR Primer Pairs, Mouse MP200187

    VEGFD cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VEGFD cDNA ORF Clone in Cloning Vector, Human HG10557-M
    VEGFD cDNA ORF Clone, Human, untagged HG10557-UT
    VEGFD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10557-ACGLN
    VEGFD cDNA ORF Clone, Human, C-GFPSpark® tag HG10557-ACG
    VEGFD cDNA ORF Clone, Human, C-OFPSpark® tag HG10557-ACR
    VEGFD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10557-CF
    VEGFD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10557-NF
    VEGFD cDNA ORF Clone, Human, C-His tag HG10557-CH
    VEGFD cDNA ORF Clone, Human, N-His tag HG10557-NH
    VEGFD cDNA ORF Clone, Human, C-HA tag HG10557-CY
    VEGFD cDNA ORF Clone, Human, N-HA tag HG10557-NY
    VEGFD cDNA ORF Clone, Human, C-Myc tag HG10557-CM
    VEGFD cDNA ORF Clone, Human, N-Myc tag HG10557-NM
    VEGFD qPCR Primer Pairs, Human HP100569
    info info
    添加购物车成功! 添加购物车失败!