Quick Order

Text Size:AAA

Rat FIGF/VEGF-D Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat FIGF cDNA Clone Product Information
NCBI RefSeq:AY032728.1
RefSeq ORF Size:981bp
cDNA Description:Full length Clone DNA of Rattus norvegicus c-fos induced growth factor with C terminal Myc tag.
Gene Synonym:Vegf-d, Figf
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Vascular endothelial growth factor D (VEGF-D), also known as C-fos induced growth factor (FIGF), belongs to the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. FIGF protein is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. FIGF protein is secreted as a non-covelent homodimer in an antiparallel fashion. Human FIGF protein is expressed in adult lung, heart, muscle, and small intestine, and is most abundantly expressed in fetal lungs and skin. FIGF protein is structurally and functionally similar to VEGF-C. Therefore, FIGF protein binds and activates VEGFR-2 (Flk1) and VEGFR-3 (Flt4) receptors, and may particularly be involved in cancers, such as breast cancer, epithelial ovarian carcinoma and so on.

References
  • Avantaggiato V, et al. (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family. Mech Dev. 73(2):221-4.
  • Rocchigiani M, et al. (1998) Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes. Genomics 47(2):207-16.
  • Karpanen T, et al. (2008) VEGF-D: a modifier of embryonic lymphangiogenesis. Blood. 112(5): 1547-8.
  • Size / Price
    Catalog: RG80104-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"