FGF11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80144-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FGF11 Reagents
CRO Services
Product recommended

All FGF11 Reagents
FGF11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Rat fibroblast growth factor 11 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF11 Background Information
Full Name
fibroblast growth factor 11

FGF11 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
FGF11 cDNA ORF Clone in Cloning Vector, Rhesus CG90282-G
FGF11 cDNA ORF Clone, Rhesus, untagged CG90282-UT
FGF11 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90282-ACGLN
FGF11 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90282-ACG
FGF11 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90282-ANG
FGF11 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90282-ACR
FGF11 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90282-ANR
FGF11 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90282-CF
FGF11 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90282-NF
FGF11 cDNA ORF Clone, Rhesus, C-His tag CG90282-CH
FGF11 cDNA ORF Clone, Rhesus, N-His tag CG90282-NH
FGF11 cDNA ORF Clone, Rhesus, C-HA tag CG90282-CY
FGF11 cDNA ORF Clone, Rhesus, N-HA tag CG90282-NY
FGF11 cDNA ORF Clone, Rhesus, C-Myc tag CG90282-CM
FGF11 cDNA ORF Clone, Rhesus, N-Myc tag CG90282-NM

FGF11 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FGF11 cDNA ORF Clone in Cloning Vector, Rat RG80144-G
FGF11 cDNA ORF Clone, Rat, untagged RG80144-UT
FGF11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80144-ACG
FGF11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80144-ACGLN
FGF11 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80144-ANG
FGF11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80144-ACR
FGF11 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80144-ANR
FGF11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80144-CF
FGF11 cDNA ORF Clone, Rat, C-His tag RG80144-CH
FGF11 cDNA ORF Clone, Rat, N-His tag RG80144-NH
FGF11 cDNA ORF Clone, Rat, C-HA tag RG80144-CY
FGF11 cDNA ORF Clone, Rat, N-HA tag RG80144-NY
FGF11 cDNA ORF Clone, Rat, C-Myc tag RG80144-CM
FGF11 cDNA ORF Clone, Rat, N-Myc tag RG80144-NM
FGF11 qPCR Primer Pairs, Rat RP300139

FGF11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FGF11 cDNA ORF Clone in Cloning Vector, Mouse MG50290-M
FGF11 cDNA ORF Clone, Mouse, untagged MG50290-UT
FGF11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50290-ACG
FGF11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50290-ACGLN
FGF11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50290-ANG
FGF11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50290-ACR
FGF11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50290-ANR
FGF11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50290-CF
FGF11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50290-NF
FGF11 cDNA ORF Clone, Mouse, C-His tag MG50290-CH
FGF11 cDNA ORF Clone, Mouse, N-His tag MG50290-NH
FGF11 cDNA ORF Clone, Mouse, C-HA tag MG50290-CY
FGF11 cDNA ORF Clone, Mouse, N-HA tag MG50290-NY
FGF11 cDNA ORF Clone, Mouse, C-Myc tag MG50290-CM
FGF11 cDNA ORF Clone, Mouse, N-Myc tag MG50290-NM
FGF11 qPCR Primer Pairs, Mouse MP200314

FGF11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FGF11 cDNA ORF Clone, Human, untagged HG24385-UT
info info
添加购物车成功! 添加购物车失败!