Fibrinogen cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80897-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Fibrinogen Reagents
CRO Services
Product recommended

All Fibrinogen Reagents
Fibrinogen cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1653 bp
Description
Full length Clone DNA of Rat fibrinogen alpha chain with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fibrinogen Background Information
Full Name
fibrinogen alpha chain

Fibrinogen cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Fibrinogen cDNA ORF Clone in Cloning Vector, Rat RG80897-U
Fibrinogen cDNA ORF Clone, Rat, untagged RG80897-UT
Fibrinogen cDNA ORF Clone, Rat, C-GFPSpark® tag RG80897-ACG
Fibrinogen Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80897-ACGLN
Fibrinogen cDNA ORF Clone, Rat, C-OFPSpark® tag RG80897-ACR
Fibrinogen cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80897-CF
Fibrinogen cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80897-NF
Fibrinogen cDNA ORF Clone, Rat, C-His tag RG80897-CH
Fibrinogen cDNA ORF Clone, Rat, N-His tag RG80897-NH
Fibrinogen cDNA ORF Clone, Rat, C-HA tag RG80897-CY
Fibrinogen cDNA ORF Clone, Rat, N-HA tag RG80897-NY
Fibrinogen cDNA ORF Clone, Rat, C-Myc tag RG80897-CM
Fibrinogen qPCR Primer Pairs, Rat RP300861

Fibrinogen cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Fibrinogen cDNA ORF Clone in Cloning Vector, Mouse MG5A7558-U
Fibrinogen cDNA ORF Clone, Mouse, untagged MG5A7558-UT
Fibrinogen cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7558-ACG
Fibrinogen Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7558-ACGLN
Fibrinogen cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7558-ACR
Fibrinogen cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7558-CF
Fibrinogen cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7558-NF
Fibrinogen cDNA ORF Clone, Mouse, C-His tag MG5A7558-CH
Fibrinogen cDNA ORF Clone, Mouse, N-His tag MG5A7558-NH
Fibrinogen cDNA ORF Clone, Mouse, C-HA tag MG5A7558-CY
Fibrinogen cDNA ORF Clone, Mouse, N-HA tag MG5A7558-NY
Fibrinogen cDNA ORF Clone, Mouse, C-Myc tag MG5A7558-CM
Fibrinogen cDNA ORF Clone, Mouse, N-Myc tag MG5A7558-NM

Fibrinogen cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Fibrinogen cDNA ORF Clone in Cloning Vector, Human HG16000-G
Fibrinogen cDNA ORF Clone, Human, untagged HG16000-UT
Fibrinogen Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16000-ACGLN
Fibrinogen cDNA ORF Clone, Human, C-GFPSpark® tag HG16000-ACG
Fibrinogen cDNA ORF Clone, Human, C-OFPSpark® tag HG16000-ACR
Fibrinogen cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16000-CF
Fibrinogen cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16000-NF
Fibrinogen cDNA ORF Clone, Human, C-His tag HG16000-CH
Fibrinogen cDNA ORF Clone, Human, N-His tag HG16000-NH
Fibrinogen cDNA ORF Clone, Human, C-HA tag HG16000-CY
Fibrinogen cDNA ORF Clone, Human, N-HA tag HG16000-NY
Fibrinogen cDNA ORF Clone, Human, C-Myc tag HG16000-CM
Fibrinogen cDNA ORF Clone, Human, N-Myc tag HG16000-NM
Fibrinogen qPCR Primer Pairs, Human HP104586
info info
添加购物车成功! 添加购物车失败!