After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat FDPS cDNA Clone Product Information
NCBI RefSeq:NM_031840.1
RefSeq ORF Size:1062bp
cDNA Description:Full length Clone DNA of Rattus norvegicus farnesyl diphosphate synthase with N terminal HA tag.
Gene Synonym:FPS, Ac2-125
Species:Rat
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Product nameProduct name
Background

Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or alkyl groups other than methyl groups. Z-farnesyl diphosphate synthase (FDPS) functions as key enzyme in isoprenoid biosynthesis which catalyzes the formation of farnesyl diphosphate, a precurcor for several classes of essential metabolites. FDPS catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Functions of FDPS may be inactivated by interferon-induced RSAD2. This inactivation may result of disruption of lipid rafts at the plasma membrane, and thus have an antiviral effect since many enveloped viruses need lipid rafts to bud efficiently out of the cell.

References
  • Pjetursson BE, et al. (2007) Comparison of survival and complication rates of tooth-supported fixed dental prostheses (FDPs) and implant-supported FDPs and single crowns (SCs). Clin Oral Implants Res. 3:97-113.
  • Eschbach S, et al. (2009) Clinical evaluation of all-ceramic posterior three-unit FDPs made of In-Ceram Zirconia. Int J Prosthodont. 22(5):490-2.
  • Moshage HJ, et al. (1990) Differential effects of endotoxin and fibrinogen degradation products (FDPS) on liver synthesis of fibrinogen and albumin: evidence for the involvement of a novel monokine in the stimulation of fibrinogen synthesis induced by FDPS. Int J Biochem. 22(12): 1393-400.
  • Size / Price
    Catalog: RG80771-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"