FCRN/FCGRT cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80094-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FCRN/FCGRT Reagents
CRO Services
Product recommended

All FCRN/FCGRT Reagents
FCRN/FCGRT cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1101 bp
Description
Full length Clone DNA of Rat Fc fragment of IgG, receptor, transporter, alpha with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FCRN/FCGRT Background Information
Full Name
Fc fragment of IgG, receptor, transporter, alpha

FCRN/FCGRT cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
FCRN/FCGRT cDNA ORF Clone in Cloning Vector, Cynomolgus CG90023-G
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, untagged CG90023-UT
FCRN/FCGRT Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90023-ACGLN
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90023-ACG
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90023-ACR
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90023-CF
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90023-NF
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, C-His tag CG90023-CH
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, N-His tag CG90023-NH
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, C-HA tag CG90023-CY
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, N-HA tag CG90023-NY
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, C-Myc tag CG90023-CM
FCRN/FCGRT cDNA ORF Clone, Cynomolgus, N-Myc tag CG90023-NM

FCRN/FCGRT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FCRN/FCGRT cDNA ORF Clone in Cloning Vector, Rat RG80094-G
FCRN/FCGRT cDNA ORF Clone, Rat, untagged RG80094-UT
FCRN/FCGRT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80094-ACGLN
FCRN/FCGRT cDNA ORF Clone, Rat, C-GFPSpark® tag RG80094-ACG
FCRN/FCGRT cDNA ORF Clone, Rat, C-OFPSpark® tag RG80094-ACR
FCRN/FCGRT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80094-NF
FCRN/FCGRT cDNA ORF Clone, Rat, C-His tag RG80094-CH
FCRN/FCGRT cDNA ORF Clone, Rat, N-His tag RG80094-NH
FCRN/FCGRT cDNA ORF Clone, Rat, C-HA tag RG80094-CY
FCRN/FCGRT cDNA ORF Clone, Rat, N-HA tag RG80094-NY
FCRN/FCGRT cDNA ORF Clone, Rat, C-Myc tag RG80094-CM
FCRN/FCGRT cDNA ORF Clone, Rat, N-Myc tag RG80094-NM
FCRN/FCGRT qPCR Primer Pairs, Rat RP300090

FCRN/FCGRT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FCRN/FCGRT cDNA ORF Clone in Cloning Vector, Mouse MG50924-G
FCRN/FCGRT cDNA ORF Clone, Mouse, untagged MG50924-UT
FCRN/FCGRT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50924-ACGLN
FCRN/FCGRT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50924-ACG
FCRN/FCGRT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50924-ACR
FCRN/FCGRT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50924-G-F
FCRN/FCGRT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50924-CF
FCRN/FCGRT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50924-NF
FCRN/FCGRT cDNA ORF Clone, Mouse, C-His tag MG50924-CH
FCRN/FCGRT cDNA ORF Clone, Mouse, N-His tag MG50924-NH
FCRN/FCGRT cDNA ORF Clone, Mouse, C-HA tag MG50924-CY
FCRN/FCGRT cDNA ORF Clone, Mouse, N-HA tag MG50924-NY
FCRN/FCGRT cDNA ORF Clone, Mouse, C-Myc tag MG50924-CM
FCRN/FCGRT cDNA ORF Clone, Mouse, N-Myc tag MG50924-NM
FCRN/FCGRT qPCR Primer Pairs, Mouse MP200893

FCRN/FCGRT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FCRN/FCGRT cDNA ORF Clone in Cloning Vector, Human HG11604-M
FCRN/FCGRT cDNA ORF Clone, Human, untagged HG11604-UT
FCRN/FCGRT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11604-ACGLN
FCRN/FCGRT cDNA ORF Clone, Human, C-GFPSpark® tag HG11604-ACG
FCRN/FCGRT cDNA ORF Clone, Human, C-OFPSpark® tag HG11604-ACR
FCRN/FCGRT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11604-CF
FCRN/FCGRT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11604-NF
FCRN/FCGRT cDNA ORF Clone, Human, C-His tag HG11604-CH
FCRN/FCGRT cDNA ORF Clone, Human, N-His tag HG11604-NH
FCRN/FCGRT cDNA ORF Clone, Human, C-HA tag HG11604-CY
FCRN/FCGRT cDNA ORF Clone, Human, N-HA tag HG11604-NY
FCRN/FCGRT cDNA ORF Clone, Human, C-Myc tag HG11604-CM
FCRN/FCGRT cDNA ORF Clone, Human, N-Myc tag HG11604-NM
FCRN/FCGRT qPCR Primer Pairs, Human HP101465
info info
添加购物车成功! 添加购物车失败!