CD32B cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80018-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD32B Reagents
CRO Services

All CD32B Reagents
CD32B cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
999 bp
Description
Full length Clone DNA of Rat Fc fragment of IgG, low affinity IIb, receptor (CD32) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD32B Background Information
Full Name
Fc fragment of IgG, low affinity IIb, receptor (CD32)

CD32B cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
CD32B cDNA ORF Clone in Cloning Vector, Cynomolgus CG90014-M
CD32B cDNA ORF Clone, Cynomolgus, untagged CG90014-UT
CD32B cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90014-ACG
CD32B Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90014-ACGLN
CD32B cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90014-ACR
CD32B cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90014-CF
CD32B cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90014-NF
CD32B cDNA ORF Clone, Cynomolgus, C-His tag CG90014-CH
CD32B cDNA ORF Clone, Cynomolgus, N-His tag CG90014-NH
CD32B cDNA ORF Clone, Cynomolgus, C-HA tag CG90014-CY
CD32B cDNA ORF Clone, Cynomolgus, N-HA tag CG90014-NY
CD32B cDNA ORF Clone, Cynomolgus, C-Myc tag CG90014-CM
CD32B cDNA ORF Clone, Cynomolgus, N-Myc tag CG90014-NM

CD32B cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
CD32B cDNA ORF Clone in Cloning Vector, Rabbit TG65011-G
CD32B cDNA ORF Clone, Rabbit, untagged TG65011-UT
CD32B Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65011-ACGLN
CD32B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65011-ACG
CD32B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65011-ACR
CD32B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65011-CF
CD32B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65011-NF
CD32B cDNA ORF Clone, Rabbit, C-His tag TG65011-CH
CD32B cDNA ORF Clone, Rabbit, N-His tag TG65011-NH
CD32B cDNA ORF Clone, Rabbit, C-HA tag TG65011-CY
CD32B cDNA ORF Clone, Rabbit, N-HA tag TG65011-NY
CD32B cDNA ORF Clone, Rabbit, C-Myc tag TG65011-CM
CD32B cDNA ORF Clone, Rabbit, N-Myc tag TG65011-NM

CD32B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD32B cDNA ORF Clone, Mouse, untagged MG5A7638-UT

CD32B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD32B cDNA ORF Clone in Cloning Vector, Human HG10259-M
CD32B cDNA ORF Clone in Cloning Vector, Human HG10260-M
CD32B cDNA ORF Clone, Human, untagged HG10259-UT
CD32B cDNA ORF Clone, Human, untagged HG10260-UT
CD32B cDNA ORF Clone, Human, C-GFPSpark® tag HG10260-ACG
CD32B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10260-ACGLN
CD32B cDNA ORF Clone, Human, C-GFPSpark® tag HG10259-ACG
CD32B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10259-ACGLN
CD32B cDNA ORF Clone, Human, C-OFPSpark® tag HG10259-ACR
CD32B cDNA ORF Clone, Human, C-OFPSpark® tag HG10260-ACR
CD32B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10259-CF
CD32B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10260-CF
CD32B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10260-NF
CD32B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10259-NF
CD32B cDNA ORF Clone, Human, C-His tag HG10259-CH
CD32B cDNA ORF Clone, Human, C-His tag HG10260-CH
CD32B cDNA ORF Clone, Human, N-His tag HG10259-NH
CD32B cDNA ORF Clone, Human, N-His tag HG10260-NH
CD32B cDNA ORF Clone, Human, C-HA tag HG10260-CY
CD32B cDNA ORF Clone, Human, C-HA tag HG10259-CY
CD32B cDNA ORF Clone, Human, N-HA tag HG10259-NY
CD32B cDNA ORF Clone, Human, N-HA tag HG10260-NY
CD32B cDNA ORF Clone, Human, C-Myc tag HG10260-CM
CD32B cDNA ORF Clone, Human, C-Myc tag HG10259-CM
CD32B cDNA ORF Clone, Human, N-Myc tag HG10260-NM
CD32B cDNA ORF Clone, Human, N-Myc tag HG10259-NM
CD32B qPCR Primer Pairs, Human HP100308

CD32B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD32B qPCR Primer Pairs, Rat RP300017
info info
添加购物车成功! 添加购物车失败!