FCER1G cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80092-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FCER1G Reagents
CRO Services
Product recommended

All FCER1G Reagents
FCER1G cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Rat Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FCER1G Background Information
Full Name
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide

FCER1G cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FCER1G cDNA ORF Clone in Cloning Vector, Rat RG80092-G
FCER1G cDNA ORF Clone, Rat, untagged RG80092-UT
FCER1G Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80092-ACGLN
FCER1G cDNA ORF Clone, Rat, C-GFPSpark® tag RG80092-ACG
FCER1G cDNA ORF Clone, Rat, C-OFPSpark® tag RG80092-ACR
FCER1G cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80092-CF
FCER1G cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80092-NF
FCER1G cDNA ORF Clone, Rat, C-His tag RG80092-CH
FCER1G cDNA ORF Clone, Rat, N-His tag RG80092-NH
FCER1G cDNA ORF Clone, Rat, C-HA tag RG80092-CY
FCER1G cDNA ORF Clone, Rat, N-HA tag RG80092-NY
FCER1G cDNA ORF Clone, Rat, N-Myc tag RG80092-NM
FCER1G qPCR Primer Pairs, Rat RP300088

FCER1G cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FCER1G cDNA ORF Clone in Cloning Vector, Mouse MG50925-G
FCER1G cDNA ORF Clone, Mouse, untagged MG50925-UT
FCER1G cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50925-ACG
FCER1G Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50925-ACGLN
FCER1G cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50925-ACR
FCER1G cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50925-CF
FCER1G cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50925-NF
FCER1G cDNA ORF Clone, Mouse, C-His tag MG50925-CH
FCER1G cDNA ORF Clone, Mouse, N-His tag MG50925-NH
FCER1G cDNA ORF Clone, Mouse, C-HA tag MG50925-CY
FCER1G cDNA ORF Clone, Mouse, N-HA tag MG50925-NY
FCER1G cDNA ORF Clone, Mouse, C-Myc tag MG50925-CM
FCER1G cDNA ORF Clone, Mouse, N-Myc tag MG50925-NM
FCER1G qPCR Primer Pairs, Mouse MP200894

FCER1G cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FCER1G cDNA ORF Clone, Human, untagged HG19029-UT
info info
添加购物车成功! 添加购物车失败!