FBXO44 cDNA ORF Clone, Rat, untagged

Cat: RG81139-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FBXO44 Reagents
CRO Services
Product recommended

All FBXO44 Reagents
FBXO44 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
768 bp
Description
Full length Clone DNA of Rat F-box protein 44.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXO44 Background Information
Full Name
F-box protein 44

FBXO44 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
FBXO44 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90724-G
FBXO44 cDNA ORF Clone, Cynomolgus, untagged CG90724-UT
FBXO44 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90724-ACGLN
FBXO44 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90724-ACG
FBXO44 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90724-ANG
FBXO44 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90724-ACR
FBXO44 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90724-ANR
FBXO44 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90724-CF
FBXO44 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90724-NF
FBXO44 cDNA ORF Clone, Cynomolgus, C-His tag CG90724-CH
FBXO44 cDNA ORF Clone, Cynomolgus, N-His tag CG90724-NH
FBXO44 cDNA ORF Clone, Cynomolgus, C-HA tag CG90724-CY
FBXO44 cDNA ORF Clone, Cynomolgus, N-HA tag CG90724-NY
FBXO44 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90724-CM
FBXO44 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90724-NM

FBXO44 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FBXO44 cDNA ORF Clone in Cloning Vector, Rat RG81139-U
FBXO44 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81139-ACG
FBXO44 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81139-ACGLN
FBXO44 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81139-ANG
FBXO44 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81139-ACR
FBXO44 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81139-ANR
FBXO44 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81139-CF
FBXO44 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81139-NF
FBXO44 cDNA ORF Clone, Rat, C-His tag RG81139-CH
FBXO44 cDNA ORF Clone, Rat, N-His tag RG81139-NH
FBXO44 cDNA ORF Clone, Rat, C-HA tag RG81139-CY
FBXO44 cDNA ORF Clone, Rat, N-HA tag RG81139-NY
FBXO44 cDNA ORF Clone, Rat, C-Myc tag RG81139-CM
FBXO44 cDNA ORF Clone, Rat, N-Myc tag RG81139-NM
FBXO44 qPCR Primer Pairs, Rat RP301096

FBXO44 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FBXO44 cDNA ORF Clone in Cloning Vector, Mouse MG53311-U
FBXO44 cDNA ORF Clone, Mouse, untagged MG53311-UT
FBXO44 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53311-ACG
FBXO44 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53311-ACGLN
FBXO44 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53311-ANG
FBXO44 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53311-ACR
FBXO44 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53311-ANR
FBXO44 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53311-CF
FBXO44 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53311-NF
FBXO44 cDNA ORF Clone, Mouse, C-His tag MG53311-CH
FBXO44 cDNA ORF Clone, Mouse, N-His tag MG53311-NH
FBXO44 cDNA ORF Clone, Mouse, C-HA tag MG53311-CY
FBXO44 cDNA ORF Clone, Mouse, N-HA tag MG53311-NY
FBXO44 cDNA ORF Clone, Mouse, C-Myc tag MG53311-CM
FBXO44 cDNA ORF Clone, Mouse, N-Myc tag MG53311-NM
info info
添加购物车成功! 添加购物车失败!