Text Size:AAA

Rat FAM118B Gene ORF cDNA clone expression plasmid, N-OFPSpark tag

DatasheetReviewsRelated ProductsProtocols
Rat FAM118B cDNA Clone Product Information
NCBI RefSeq:NM_001025283.1
RefSeq ORF Size:1053bp
cDNA Description:Full length Clone DNA of Rattus norvegicus family with sequence similarity 118, member B with N terminal OFPSpark / RFP tag.
Gene Synonym:Ppp4r1l, RGD1307173
Species:Rat
Vector:pCMV3-N-OFPSpark
Plasmid:
Restriction Site:
Tag Sequence:OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
OFP (OFPSpark) / RFP Tag Info

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Product nameProduct name
Size / Price
Catalog: RG81067-ANR
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"