Quick Order

Rat BLBP/FABP7 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Rat FABP7 cDNA Clone Product Information
NCBI RefSeq:NM_030832.2
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Rattus norvegicus fatty acid binding protein 7, brain with N terminal His tag.
Gene Synonym:Fabp7
Species:Rat
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

BLBP, also known as FABP7, is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP7 binds DHA with the highest affinity among all of the FABPs. FABPs may play roles in fatty acid uptake, transport, and metabolism. BLBP is expressed, during development, in radial glia by the activation of notch receptors. It was shown that reelin induces FABP7 expression in neural progenitor cells via notch-1 activation. BLBP variation is linked to weak prepulse inhibition(PPI) in mice and deficit in PPI is an endophenotypic trait observed in schizophrenia patients and their relatives.

References
  • Shi YE, et al. (1997) Antitumor activity of the novel human breast cancer growth inhibitor, mammary-derived growth inhibitor-related gene, MRG. Cancer Res. 57(15):3084-91.
  • Young JK, et al. (1997) Immunoreactivity for brain-fatty acid binding protein in gomori-positive astrocytes. Glia. 16(3):218-26.
  • Xu LZ, et al. (1996) Ligand specificity of brain lipid-binding protein. J Biol Chem. 271(40): 24711-9.
  • Size / Price
    Catalog: RG80474-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"