Quick Order

Rat Coagulation Factor II/F2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat F2 cDNA Clone Product Information
    NCBI RefSeq:NM_022924.2
    RefSeq ORF Size:1854bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus coagulation factor II with N terminal Myc tag.
    Gene Synonym:F2
    Species:Rat
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with F2 qPCR primers for gene expression analysis, RP300686 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Coagulation Factor II Protein (FII, F2 Protein or Prothrombin) is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. Coagulation Factor II Protein (FII, F2 Protein) also plays a role in maintaining vascular integrity during development and postnatal life. Prothrombin / Coagulation Factor II is activated on the surface of a phospholipid membrane that binds the amino end of prothrombin / Coagulation Factor II and factor Va and Xa in Ca-dependent interactions; factor Xa removes the activation peptide and cleaves the remaining part into light and heavy chains. The activation process starts slowly because factor V itself has to be activated by the initial, small amounts of thrombin. Prothrombin / Coagulation Factor II is expressed by the liver and secreted in plasma. Defects in prothrombin / Coagulation Factor II are the cause of factor II deficiency (FA2D). It is very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Defects in Coagulation Factor II are also a cause of susceptibility to thrombosis. It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation.

    References
  • Danneberg J, et al. (1998) Reliable genotyping of the G-20210-A mutation of Coagulation Factor II (prothrombin). Clin Chem. 44(2): 349-51.
  • Redondo M, et al. (1999) Coagulation Factor s II, V, VII, and X, prothrombin gene 20210GA transition, and factor V Leiden in coronary artery disease: high factor V clotting activity is an independent risk factor for myocardial infarction. Arterioscler Thromb Vasc Biol. 19(4): 1020-5.
  • Miletich JP, et al. (1980) The synthesis of sulfated dextran beads for isolation of human plasma Coagulation Factor s II, IX, and X. Anal Biochem. 105(2): 304-10.
  • Size / Price
    Catalog: RG80722-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"