ERP44 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80507-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ERP44 Reagents
CRO Services
Product recommended

All ERP44 Reagents
ERP44 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Rat endoplasmic reticulum protein 44 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERP44 Background Information
Full Name
endoplasmic reticulum protein 44

ERP44 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ERP44 cDNA ORF Clone in Cloning Vector, Rat RG80507-U
ERP44 cDNA ORF Clone, Rat, untagged RG80507-UT
ERP44 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80507-ACGLN
ERP44 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80507-ACG
ERP44 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80507-ACR
ERP44 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80507-CF
ERP44 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80507-NF
ERP44 cDNA ORF Clone, Rat, C-His tag RG80507-CH
ERP44 cDNA ORF Clone, Rat, N-His tag RG80507-NH
ERP44 cDNA ORF Clone, Rat, N-HA tag RG80507-NY
ERP44 cDNA ORF Clone, Rat, C-Myc tag RG80507-CM
ERP44 cDNA ORF Clone, Rat, N-Myc tag RG80507-NM
ERP44 qPCR Primer Pairs, Rat RP300471

ERP44 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ERP44 cDNA ORF Clone in Cloning Vector, Mouse MG52783-G
ERP44 cDNA ORF Clone, Mouse, untagged MG52783-UT
ERP44 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52783-ACGLN
ERP44 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52783-ACG
ERP44 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52783-ACR
ERP44 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52783-CF
ERP44 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52783-NF
ERP44 cDNA ORF Clone, Mouse, C-His tag MG52783-CH
ERP44 cDNA ORF Clone, Mouse, N-His tag MG52783-NH
ERP44 cDNA ORF Clone, Mouse, C-HA tag MG52783-CY
ERP44 cDNA ORF Clone, Mouse, N-HA tag MG52783-NY
ERP44 cDNA ORF Clone, Mouse, C-Myc tag MG52783-CM
ERP44 cDNA ORF Clone, Mouse, N-Myc tag MG52783-NM

ERP44 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ERP44 cDNA ORF Clone in Cloning Vector, Human HG15077-G
ERP44 cDNA ORF Clone, Human, untagged HG15077-UT
ERP44 cDNA ORF Clone, Human, C-GFPSpark® tag HG15077-ACG
ERP44 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15077-ACGLN
ERP44 cDNA ORF Clone, Human, C-OFPSpark® tag HG15077-ACR
ERP44 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15077-CF
ERP44 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15077-NF
ERP44 cDNA ORF Clone, Human, C-His tag HG15077-CH
ERP44 cDNA ORF Clone, Human, N-His tag HG15077-NH
ERP44 cDNA ORF Clone, Human, C-HA tag HG15077-CY
ERP44 cDNA ORF Clone, Human, N-HA tag HG15077-NY
ERP44 cDNA ORF Clone, Human, C-Myc tag HG15077-CM
ERP44 cDNA ORF Clone, Human, N-Myc tag HG15077-NM
ERP44 qPCR Primer Pairs, Human HP103705
info info
添加购物车成功! 添加购物车失败!