Quick Order

Rat ERBB4/HER4 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat ERBB4 cDNA Clone Product Information
NCBI RefSeq:AY375307.1
RefSeq ORF Size:3879bp
cDNA Description:Full length Clone DNA of Rattus norvegicus v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) with C terminal Myc tag.
Gene Synonym:Erbb4
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ERBB4 is a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. ERBB4 is expressed at highest levels in brain, heart, kidney, in addition to skeletal muscle, parathyroid, cerebellum, pituitary, spleen, testis and breast. And lower levels in thymus, lung, salivary gland, and pancreas. It specifically binds to and is activated by neuregulins, NRG-2, NRG-3, heparin-binding EGF-like growth factor, betacellulin and NTAK. ERBB4 also can be activated by other factors and induces a variety of cellular responses including mitogenesis and differentiation. ERBB4 regulates development of the heart, the central nervous system and the mammary gland, gene transcription, cell proliferation, differentiation, migration and apoptosis. It is required for normal cardiac muscle differentiation during embryonic development, and for postnatal cardiomyocyte proliferation. ERBB4 also play a role on the normal development of the embryonic central nervous system, especially for normal neural crest cell migration and normal axon guidance. It is required for mammary gland differentiation, induction of milk proteins and lactation.

References
  • Huang, Y Z, et al. (2000) Regulation of neuregulin signaling by PSD-95 interacting with ErbB4 at CNS synapses. Neuron. 26(2):443-55.
  • Garcia, R A, et al. (2000) The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. Proc Natl Acad Sci. 97(7):3596-601.
  • Silberberg G, et al. (2006) The involvement of ErbB4 with schizophrenia: association and expression studies. Am J Med Genet. 141(B2):142-8.
  • Sardi SP, et al. (2006) Presenilin-dependent ErbB4 nuclear signaling regulates the timing of astrogenesis in the developing brain. Cell. 127(1):185-97.
  • Size / Price
    Catalog: RG80125-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"