Quick Order

Rat EEBB3/HER3 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat ERBB3 cDNA Clone Product Information
NCBI RefSeq:NM_017218.2
RefSeq ORF Size:4020bp
cDNA Description:Full length Clone DNA of Rattus norvegicus v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) with C terminal Myc tag.
Gene Synonym:Erbb3
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ErbB3, also known as Her3(human epidermal growth factor receptor3), is a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound glycoprotein has a neuregulin binding domain but has not an active kinase domain., and therefore can not mediate the intracellular signal transduction through protein phosphorylation. However, its heterodimer with ErbB2 or other EGFR members responsible for tyrosine phosphorylation forms a receptor complex with high affinity, and initiates the related pathway which lead to cell proliferation or differentiation. ErbB3 has been shown to implicated in numerous cancers, including prostate, bladder, and breast tumors. This protein has different isoforms derived from alternative splicing variants, and among which, the secreted isoform lacking the intermembrane region modulates the activity of membrane-bound form.

Size / Price
Catalog: RG80111-CM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"