Erythropoietin cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80055-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Erythropoietin Reagents
CRO Services
Product recommended

All Erythropoietin Reagents
Erythropoietin cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Rat erythropoietin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Erythropoietin Background Information

Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four alpha helical bundles. Erythropoietin can be found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. It also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. Erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. It is produced by kidney or liver of adult mammals and by liver of fetal or neonatal mammals. Genetic variation in erythropoietin is associated with susceptbility to microvascular complications of diabetes type 2. These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. It has a longer circulating half-life in vivo. Erythropoietin is being much misused as a performance-enhancing drug in endurance athletes.

Full Name
erythropoietin
References
  • Jelkmann W, et al. (2007) Erythropoietin after a century of research: younger than ever. Eur J Haematol. 78 (3):183-205.
  • Miyake T, et al. (1997) Purification of human erythropoietin. J Biol Chem. 252(15):5558-64.
  • Haroon ZA, et al. (2003) A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol. 163(3):993-1000.
  • Siren AL, et al. (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci. 98(7):4044-9.
  • Erythropoietin cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Erythropoietin cDNA ORF Clone in Cloning Vector, Rhesus CG90133-G
    Erythropoietin cDNA ORF Clone, Rhesus, untagged CG90133-UT
    Erythropoietin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90133-ACG
    Erythropoietin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90133-ACGLN
    Erythropoietin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90133-ACR
    Erythropoietin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90133-CF
    Erythropoietin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90133-NF
    Erythropoietin cDNA ORF Clone, Rhesus, C-His tag CG90133-CH
    Erythropoietin cDNA ORF Clone, Rhesus, N-His tag CG90133-NH
    Erythropoietin cDNA ORF Clone, Rhesus, C-HA tag CG90133-CY
    Erythropoietin cDNA ORF Clone, Rhesus, N-HA tag CG90133-NY
    Erythropoietin cDNA ORF Clone, Rhesus, C-Myc tag CG90133-CM
    Erythropoietin cDNA ORF Clone, Rhesus, N-Myc tag CG90133-NM

    Erythropoietin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Erythropoietin cDNA ORF Clone in Cloning Vector, Rat RG80055-M
    Erythropoietin cDNA ORF Clone, Rat, untagged RG80055-UT
    Erythropoietin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80055-ACGLN
    Erythropoietin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80055-ACG
    Erythropoietin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80055-ACR
    Erythropoietin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80055-NF
    Erythropoietin cDNA ORF Clone, Rat, C-His tag RG80055-CH
    Erythropoietin cDNA ORF Clone, Rat, N-His tag RG80055-NH
    Erythropoietin cDNA ORF Clone, Rat, C-HA tag RG80055-CY
    Erythropoietin cDNA ORF Clone, Rat, N-HA tag RG80055-NY
    Erythropoietin cDNA ORF Clone, Rat, C-Myc tag RG80055-CM
    Erythropoietin cDNA ORF Clone, Rat, N-Myc tag RG80055-NM
    Erythropoietin qPCR Primer Pairs, Rat RP300053

    Erythropoietin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Erythropoietin cDNA ORF Clone in Cloning Vector, Mouse MG51099-G
    Erythropoietin cDNA ORF Clone, Mouse, untagged MG51099-UT
    Erythropoietin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51099-ACGLN
    Erythropoietin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51099-ACG
    Erythropoietin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51099-ACR
    Erythropoietin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51099-CF
    Erythropoietin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51099-NF
    Erythropoietin cDNA ORF Clone, Mouse, C-His tag MG51099-CH
    Erythropoietin cDNA ORF Clone, Mouse, N-His tag MG51099-NH
    Erythropoietin cDNA ORF Clone, Mouse, C-HA tag MG51099-CY
    Erythropoietin cDNA ORF Clone, Mouse, N-HA tag MG51099-NY
    Erythropoietin cDNA ORF Clone, Mouse, C-Myc tag MG51099-CM
    Erythropoietin cDNA ORF Clone, Mouse, N-Myc tag MG51099-NM
    Erythropoietin qPCR Primer Pairs, Mouse MP201052

    Erythropoietin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Erythropoietin cDNA ORF Clone in Cloning Vector, Human HG10236-M
    Erythropoietin cDNA ORF Clone, Human, untagged HG10236-UT
    Erythropoietin cDNA ORF Clone, Human, C-GFPSpark® tag HG10236-ACG
    Erythropoietin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10236-ACGLN
    Erythropoietin cDNA ORF Clone, Human, C-OFPSpark® tag HG10236-ACR
    Erythropoietin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10236-CF
    Erythropoietin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10236-NF
    Erythropoietin cDNA ORF Clone, Human, C-His tag HG10236-CH
    Erythropoietin cDNA ORF Clone, Human, N-His tag HG10236-NH
    Erythropoietin cDNA ORF Clone, Human, C-HA tag HG10236-CY
    Erythropoietin cDNA ORF Clone, Human, N-HA tag HG10236-NY
    Erythropoietin cDNA ORF Clone, Human, C-Myc tag HG10236-CM
    Erythropoietin cDNA ORF Clone, Human, N-Myc tag HG10236-NM
    Erythropoietin qPCR Primer Pairs, Human HP102356
    info info
    添加购物车成功! 添加购物车失败!