EphB6 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80122-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EphB6 Reagents
CRO Services
Product recommended

All EphB6 Reagents
EphB6 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3042 bp
Description
Full length Clone DNA of Rat Eph receptor B6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB6 Background Information

Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB6 is an unusual Eph receptor, lacking catalytic capacity due to alterations in its kinase domain. Interestingly, increased metastatic activity is associated with reduced EphB6 receptor expression in several tumor types, including breast cancer. This emphasizes the potential of EphB6 to act as a suppressor of cancer aggressiveness. EphB6 suppress cancer invasiveness through c-Cbl-dependent signaling, morphologic changes, and cell attachment and indicate that EphB6 may represent a useful prognostic marker and a promising target for therapeutic approaches. EphB6 can both positively and negatively regulate cell adhesion and migration, and suggest that tyrosine phosphorylation of the receptor by an Src family kinase acts as the molecular switch for the functional transition. In addition, Ephrin-B2 may be a physiological ligand for the EphB6 receptor.

Full Name
EPH receptor B6
References
  • Munthe E, et al. (2000)Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 466(1): 169-74.
  • Matsuoka H, et al. (2005) Biphasic functions of the kinase-defective Ephb6 receptor in cell adhesion and migration. J Biol Chem. 280(32): 29355-63.
  • Truitt L, et al. (2010) The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 70(3): 1141-53.
  • EphB6 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    EphB6 cDNA ORF Clone in Cloning Vector, Rhesus CG90045-G

    EphB6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EphB6 cDNA ORF Clone in Cloning Vector, Rat RG80122-G
    EphB6 cDNA ORF Clone, Rat, untagged RG80122-UT
    EphB6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80122-ACGLN
    EphB6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80122-ACG
    EphB6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80122-ACR
    EphB6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80122-CF
    EphB6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80122-NF
    EphB6 cDNA ORF Clone, Rat, C-His tag RG80122-CH
    EphB6 cDNA ORF Clone, Rat, N-His tag RG80122-NH
    EphB6 cDNA ORF Clone, Rat, C-HA tag RG80122-CY
    EphB6 cDNA ORF Clone, Rat, N-HA tag RG80122-NY
    EphB6 cDNA ORF Clone, Rat, N-Myc tag RG80122-NM
    EphB6 qPCR Primer Pairs, Rat RP300117

    EphB6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphB6 cDNA ORF Clone in Cloning Vector, Mouse MG51123-G
    EphB6 cDNA ORF Clone, Mouse, untagged MG51123-UT
    EphB6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51123-ACGLN
    EphB6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51123-ACG
    EphB6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51123-ACR
    EphB6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51123-CF
    EphB6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51123-NF
    EphB6 cDNA ORF Clone, Mouse, C-His tag MG51123-CH
    EphB6 cDNA ORF Clone, Mouse, N-His tag MG51123-NH
    EphB6 cDNA ORF Clone, Mouse, C-HA tag MG51123-CY
    EphB6 cDNA ORF Clone, Mouse, N-HA tag MG51123-NY
    EphB6 cDNA ORF Clone, Mouse, C-Myc tag MG51123-CM
    EphB6 cDNA ORF Clone, Mouse, N-Myc tag MG51123-NM

    EphB6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphB6 cDNA ORF Clone in Cloning Vector, Human HG10197-M
    EphB6 cDNA ORF Clone, Human, untagged HG10197-UT
    EphB6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10197-ACG
    EphB6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10197-ACGLN
    EphB6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10197-ACR
    EphB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10197-CF
    EphB6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10197-NF
    EphB6 cDNA ORF Clone, Human, C-His tag HG10197-CH
    EphB6 cDNA ORF Clone, Human, N-His tag HG10197-NH
    EphB6 cDNA ORF Clone, Human, C-HA tag HG10197-CY
    EphB6 cDNA ORF Clone, Human, N-HA tag HG10197-NY
    EphB6 cDNA ORF Clone, Human, C-Myc tag HG10197-CM
    EphB6 cDNA ORF Clone, Human, N-Myc tag HG10197-NM
    EphB6 qPCR Primer Pairs, Human HP100043
    info info
    添加购物车成功! 添加购物车失败!