EphB2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80124-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EphB2 Reagents
CRO Services
Product recommended

All EphB2 Reagents
EphB2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2961 bp
Description
Full length Clone DNA of Rat Eph receptor B2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB2 Background Information

Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine formation. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.

Full Name
EPH receptor B2
References
  • Zisch AH, et al. (1998) Complex formation between EphB2 and Src requires phosphorylation of tyrosine 611 in the EphB2 juxtamembrane region. Oncogene. 16 (20): 2657-70.
  • Yu HH, et al. (2001) Multiple signaling interactions of Abl and Arg kinases with the EphB2 receptor. Oncogene. 20 (30): 3995-4006.
  • Zisch AH, et al. (2000) Replacing two conserved tyrosines of the EphB2 receptor with glutamic acid prevents binding of SH2 domains without abrogating kinase activity and biological responses. Oncogene. 19 (2): 177-87.
  • EphB2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EphB2 cDNA ORF Clone in Cloning Vector, Rat RG80124-G
    EphB2 cDNA ORF Clone, Rat, untagged RG80124-UT
    EphB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80124-ACGLN
    EphB2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80124-ACG
    EphB2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80124-ACR
    EphB2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80124-CF
    EphB2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80124-NF
    EphB2 cDNA ORF Clone, Rat, C-His tag RG80124-CH
    EphB2 cDNA ORF Clone, Rat, N-His tag RG80124-NH
    EphB2 cDNA ORF Clone, Rat, C-HA tag RG80124-CY
    EphB2 cDNA ORF Clone, Rat, N-HA tag RG80124-NY
    EphB2 cDNA ORF Clone, Rat, N-Myc tag RG80124-NM
    EphB2 qPCR Primer Pairs, Rat RP300119

    EphB2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphB2 cDNA ORF Clone in Cloning Vector, Human HG10762-M
    EphB2 cDNA ORF Clone, Human, untagged HG10762-UT
    EphB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10762-ACG
    EphB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10762-ACGLN
    EphB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10762-ACR
    EphB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10762-CF
    EphB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10762-NF
    EphB2 cDNA ORF Clone, Human, C-His tag HG10762-CH
    EphB2 cDNA ORF Clone, Human, N-His tag HG10762-NH
    EphB2 cDNA ORF Clone, Human, C-HA tag HG10762-CY
    EphB2 cDNA ORF Clone, Human, N-HA tag HG10762-NY
    EphB2 cDNA ORF Clone, Human, C-Myc tag HG10762-CM
    EphB2 cDNA ORF Clone, Human, N-Myc tag HG10762-NM
    EphB2 qPCR Primer Pairs, Human HP100901
    info info
    添加购物车成功! 添加购物车失败!