EphA4 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80123-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EphA4 Reagents
CRO Services
Product recommended

All EphA4 Reagents
EphA4 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2961 bp
Description
Full length Clone DNA of Rat Eph receptor A4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphA4 Background Information

EPH receptor A4 (ephrin type-A receptor 4), also known as EphA4, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. EphA4 is enriched on dendritic spines of pyramidal neurons in the adult mouse hippocampus, and ephrin-A3 is localized on astrocytic processes that envelop spines. Eph receptor−mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). The extracellular domain of an EphA4 interacts with ephrin ligands, which may be tethered to neighbouring cells. Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer.

Full Name
EPH receptor A4
References
  • Murai KK, et al. (2003) Control of hippocampal dendritic spine morphology through ephrin-A3/EphA4 signaling. Nat Neurosci. 6(2): 153-60.
  • Kullander K, et al. (2003) Role of EphA4 and EphrinB3 in local neuronal circuits that control walking. Science. 299(5614): 1889-92.
  • Smith A, et al. (1997) The EphA4 and EphB1 receptor tyrosine kinases and ephrin-B2 ligand regulate targeted migration of branchial neural crest cells. Curr Biol. 7(8): 561-70.
  • EphA4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    EphA4 cDNA ORF Clone in Cloning Vector, Rhesus CG90039-G
    EphA4 cDNA ORF Clone, Rhesus, untagged CG90039-UT
    EphA4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90039-ACGLN
    EphA4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90039-ACG
    EphA4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90039-ACR
    EphA4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90039-CF
    EphA4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90039-NF
    EphA4 cDNA ORF Clone, Rhesus, C-His tag CG90039-CH
    EphA4 cDNA ORF Clone, Rhesus, N-His tag CG90039-NH
    EphA4 cDNA ORF Clone, Rhesus, C-HA tag CG90039-CY
    EphA4 cDNA ORF Clone, Rhesus, N-HA tag CG90039-NY
    EphA4 cDNA ORF Clone, Rhesus, C-Myc tag CG90039-CM
    EphA4 cDNA ORF Clone, Rhesus, N-Myc tag CG90039-NM

    EphA4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EphA4 cDNA ORF Clone in Cloning Vector, Rat RG80123-G
    EphA4 cDNA ORF Clone, Rat, untagged RG80123-UT
    EphA4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80123-ACGLN
    EphA4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80123-ACG
    EphA4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80123-ACR
    EphA4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80123-CF
    EphA4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80123-NF
    EphA4 cDNA ORF Clone, Rat, C-His tag RG80123-CH
    EphA4 cDNA ORF Clone, Rat, N-His tag RG80123-NH
    EphA4 cDNA ORF Clone, Rat, C-HA tag RG80123-CY
    EphA4 cDNA ORF Clone, Rat, N-HA tag RG80123-NY
    EphA4 cDNA ORF Clone, Rat, N-Myc tag RG80123-NM
    EphA4 qPCR Primer Pairs, Rat RP300118

    EphA4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphA4 cDNA ORF Clone in Cloning Vector, Mouse MG50575-M
    EphA4 cDNA ORF Clone, Mouse, untagged MG50575-UT
    EphA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50575-ACG
    EphA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50575-ACGLN
    EphA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50575-ACR
    EphA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50575-CF
    EphA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50575-NF
    EphA4 cDNA ORF Clone, Mouse, C-His tag MG50575-CH
    EphA4 cDNA ORF Clone, Mouse, N-His tag MG50575-NH
    EphA4 cDNA ORF Clone, Mouse, C-HA tag MG50575-CY
    EphA4 cDNA ORF Clone, Mouse, N-HA tag MG50575-NY
    EphA4 cDNA ORF Clone, Mouse, C-Myc tag MG50575-CM
    EphA4 cDNA ORF Clone, Mouse, N-Myc tag MG50575-NM
    EphA4 qPCR Primer Pairs, Mouse MP200567

    EphA4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphA4 cDNA ORF Clone in Cloning Vector, Human HG11314-M
    EphA4 cDNA ORF Clone, Human, untagged HG11314-UT
    EphA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11314-ACG
    EphA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11314-ACGLN
    EphA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11314-ACR
    EphA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11314-CF
    EphA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11314-NF
    EphA4 cDNA ORF Clone, Human, C-His tag HG11314-CH
    EphA4 cDNA ORF Clone, Human, N-His tag HG11314-NH
    EphA4 cDNA ORF Clone, Human, C-HA tag HG11314-CY
    EphA4 cDNA ORF Clone, Human, N-HA tag HG11314-NY
    EphA4 cDNA ORF Clone, Human, C-Myc tag HG11314-CM
    EphA4 cDNA ORF Clone, Human, N-Myc tag HG11314-NM
    EphA4 qPCR Primer Pairs, Human HP101200
    info info
    添加购物车成功! 添加购物车失败!