Quick Order

Rat EpCAM/TROP-1/TACSTD1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat EPCAM cDNA Clone Product Information
    NCBI RefSeq:NM_138541.1
    RefSeq ORF Size:948bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus epithelial cell adhesion molecule with N terminal His tag.
    Gene Synonym:Egp314, Tacstd1, Epcam
    Species:Rat
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EpCAM qPCR primers for gene expression analysis, RP300282 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â… transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"