After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat ENPEP ORF mammalian expression plasmid, N-His tag

Datasheet Reviews Related Products Protocols
Rat ENPEP cDNA Clone Product Information
NCBI RefSeq:NM_022251.2
RefSeq ORF Size:2838bp
cDNA Description:Full length Clone DNA of Rattus norvegicus glutamyl aminopeptidase with N terminal His tag.
Gene Synonym:Enpep
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ENPEP, also known as aminopeptidase A, is a member of the peptidase M1 family. Members of this family are involved in response to cadmium ion and proteolysis. They located in 6 components and are expressed in 26 plant structures. ENPEP is expressed by epithelial cells of the proximal tubule cells and the glomerulus of the nephron. It also can be detected in a variety of other tissues. ENPEP probably plays a role in regulating growth and differentiation of early B-lineage cells. It also may play a role in the catabolic pathway of the renin-angiotensin system. ENPEP is a zinc-dependent membrane-bound aminopeptidase that catalyzes the cleavage of glutamatic and aspartatic amino acid residues from the N-terminus of polypeptides. It degrades vasoconstricting angiotensin II into angiotensin III and therefore helps to regulate blood pressure.

References
  • Speth RC, et al. (2008) The significance of brain aminopeptidases in the regulation of the actions of angiotensin peptides in the brain. Heart Fail Rev. 13(3):299-309.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Pérez I, et al. (2009) Increased APN/CD13 and acid aminopeptidase activities in head and neck squamous cell carcinoma. Head Neck. 31(10):1335-40.
  • Size / Price
    Catalog:  RG80387-NH
    List Price:    (Save )
    Price:       [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"