Text Size:AAA

Rat Endoglin/CD105 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Rat ENG cDNA Clone Product Information
    NCBI RefSeq:NM_001010968.2
    RefSeq ORF Size:1953bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus endoglin with N terminal HA tag.
    Gene Synonym:MGC124909, Eng
    Species:Rat
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ENG qPCR primers for gene expression analysis, RP300136 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

    Size / Price
    Catalog: RG80140-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"