EIF3S2/EIF3I cDNA ORF Clone, Rat, N-HA tag

Cat: RG80746-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF3S2/EIF3I Reagents
CRO Services
Product recommended

All EIF3S2/EIF3I Reagents
EIF3S2/EIF3I cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
978 bp
Description
Full length Clone DNA of Rat eukaryotic translation initiation factor 3, subunit I with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF3S2/EIF3I Background Information
Full Name
eukaryotic translation initiation factor 3, subunit I

EIF3S2/EIF3I cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF3S2/EIF3I cDNA ORF Clone in Cloning Vector, Rat RG80746-U
EIF3S2/EIF3I cDNA ORF Clone, Rat, untagged RG80746-UT
EIF3S2/EIF3I cDNA ORF Clone, Rat, C-GFPSpark® tag RG80746-ACG
EIF3S2/EIF3I Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80746-ACGLN
EIF3S2/EIF3I cDNA ORF Clone, Rat, N-GFPSpark® tag RG80746-ANG
EIF3S2/EIF3I cDNA ORF Clone, Rat, C-OFPSpark® tag RG80746-ACR
EIF3S2/EIF3I cDNA ORF Clone, Rat, N-OFPSpark® tag RG80746-ANR
EIF3S2/EIF3I cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80746-CF
EIF3S2/EIF3I cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80746-NF
EIF3S2/EIF3I cDNA ORF Clone, Rat, C-His tag RG80746-CH
EIF3S2/EIF3I cDNA ORF Clone, Rat, N-His tag RG80746-NH
EIF3S2/EIF3I cDNA ORF Clone, Rat, C-HA tag RG80746-CY
EIF3S2/EIF3I cDNA ORF Clone, Rat, C-Myc tag RG80746-CM
EIF3S2/EIF3I cDNA ORF Clone, Rat, N-Myc tag RG80746-NM
EIF3S2/EIF3I qPCR Primer Pairs, Rat RP300710

EIF3S2/EIF3I cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF3S2/EIF3I cDNA ORF Clone in Cloning Vector, Human HG16651-U
EIF3S2/EIF3I cDNA ORF Clone, Human, untagged HG16651-UT
EIF3S2/EIF3I cDNA ORF Clone, Human, C-GFPSpark® tag HG16651-ACG
EIF3S2/EIF3I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16651-ACGLN
EIF3S2/EIF3I cDNA ORF Clone, Human, N-GFPSpark® tag HG16651-ANG
EIF3S2/EIF3I cDNA ORF Clone, Human, C-OFPSpark® tag HG16651-ACR
EIF3S2/EIF3I cDNA ORF Clone, Human, N-OFPSpark® tag HG16651-ANR
EIF3S2/EIF3I cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16651-CF
EIF3S2/EIF3I cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16651-NF
EIF3S2/EIF3I cDNA ORF Clone, Human, C-His tag HG16651-CH
EIF3S2/EIF3I cDNA ORF Clone, Human, N-His tag HG16651-NH
EIF3S2/EIF3I cDNA ORF Clone, Human, C-HA tag HG16651-CY
EIF3S2/EIF3I cDNA ORF Clone, Human, N-HA tag HG16651-NY
EIF3S2/EIF3I cDNA ORF Clone, Human, C-Myc tag HG16651-CM
EIF3S2/EIF3I cDNA ORF Clone, Human, N-Myc tag HG16651-NM
info info
添加购物车成功! 添加购物车失败!