eIF2alpha cDNA ORF Clone, Rat, N-HA tag

Cat: RG80536-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All eIF2alpha Reagents
CRO Services
Product recommended

All eIF2alpha Reagents
eIF2alpha cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
948 bp
Description
Full length Clone DNA of Rat eukaryotic translation initiation factor 2, subunit 1 alpha with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2alpha Background Information
Full Name
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa

eIF2alpha cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
eIF2alpha cDNA ORF Clone in Cloning Vector, Rhesus CG90456-G
eIF2alpha cDNA ORF Clone, Rhesus, untagged CG90456-UT
eIF2alpha cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90456-ACG
eIF2alpha Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90456-ACGLN
eIF2alpha cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90456-ANG
eIF2alpha cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90456-ACR
eIF2alpha cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90456-ANR
eIF2alpha cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90456-CF
eIF2alpha cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90456-NF
eIF2alpha cDNA ORF Clone, Rhesus, C-His tag CG90456-CH
eIF2alpha cDNA ORF Clone, Rhesus, N-His tag CG90456-NH
eIF2alpha cDNA ORF Clone, Rhesus, C-HA tag CG90456-CY
eIF2alpha cDNA ORF Clone, Rhesus, N-HA tag CG90456-NY
eIF2alpha cDNA ORF Clone, Rhesus, C-Myc tag CG90456-CM
eIF2alpha cDNA ORF Clone, Rhesus, N-Myc tag CG90456-NM

eIF2alpha cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
eIF2alpha cDNA ORF Clone in Cloning Vector, Rat RG80536-U
eIF2alpha cDNA ORF Clone, Rat, untagged RG80536-UT
eIF2alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80536-ACGLN
eIF2alpha cDNA ORF Clone, Rat, C-GFPSpark® tag RG80536-ACG
eIF2alpha cDNA ORF Clone, Rat, N-GFPSpark® tag RG80536-ANG
eIF2alpha cDNA ORF Clone, Rat, C-OFPSpark® tag RG80536-ACR
eIF2alpha cDNA ORF Clone, Rat, N-OFPSpark® tag RG80536-ANR
eIF2alpha cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80536-CF
eIF2alpha cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80536-NF
eIF2alpha cDNA ORF Clone, Rat, C-His tag RG80536-CH
eIF2alpha cDNA ORF Clone, Rat, N-His tag RG80536-NH
eIF2alpha cDNA ORF Clone, Rat, C-HA tag RG80536-CY
eIF2alpha cDNA ORF Clone, Rat, C-Myc tag RG80536-CM
eIF2alpha cDNA ORF Clone, Rat, N-Myc tag RG80536-NM
eIF2alpha qPCR Primer Pairs, Rat RP300500

eIF2alpha cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
eIF2alpha cDNA ORF Clone in Cloning Vector, Mouse MG53141-G
eIF2alpha cDNA ORF Clone, Mouse, untagged MG53141-UT
eIF2alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53141-ACG
eIF2alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53141-ACGLN
eIF2alpha cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53141-ANG
eIF2alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53141-ACR
eIF2alpha cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53141-ANR
eIF2alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53141-CF
eIF2alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53141-NF
eIF2alpha cDNA ORF Clone, Mouse, C-His tag MG53141-CH
eIF2alpha cDNA ORF Clone, Mouse, N-His tag MG53141-NH
eIF2alpha cDNA ORF Clone, Mouse, C-HA tag MG53141-CY
eIF2alpha cDNA ORF Clone, Mouse, N-HA tag MG53141-NY
eIF2alpha cDNA ORF Clone, Mouse, C-Myc tag MG53141-CM
eIF2alpha cDNA ORF Clone, Mouse, N-Myc tag MG53141-NM

eIF2alpha cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF2alpha cDNA ORF Clone in Cloning Vector, Human HG13107-G
eIF2alpha cDNA ORF Clone, Human, untagged HG13107-UT
eIF2alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13107-ACGLN
eIF2alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG13107-ACG
eIF2alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG13107-ANG
eIF2alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG13107-ACR
eIF2alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG13107-ANR
eIF2alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13107-CF
eIF2alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13107-NF
eIF2alpha cDNA ORF Clone, Human, C-His tag HG13107-CH
eIF2alpha cDNA ORF Clone, Human, N-His tag HG13107-NH
eIF2alpha cDNA ORF Clone, Human, C-HA tag HG13107-CY
eIF2alpha cDNA ORF Clone, Human, N-HA tag HG13107-NY
eIF2alpha cDNA ORF Clone, Human, C-Myc tag HG13107-CM
eIF2alpha cDNA ORF Clone, Human, N-Myc tag HG13107-NM
eIF2alpha qPCR Primer Pairs, Human HP101729
info info
添加购物车成功! 添加购物车失败!