EGFR cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80100-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EGFR Reagents
CRO Services
Product recommended

All EGFR Reagents
EGFR cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3630 bp
Description
Full length Clone DNA of Rat epidermal growth factor receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGFR Background Information

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
epidermal growth factor receptor
References
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • EGFR cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    EGFR cDNA ORF Clone in Cloning Vector, Canine DG70026-G
    EGFR cDNA ORF Clone, Canine, untagged DG70026-UT
    EGFR Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70026-ACGLN
    EGFR cDNA ORF Clone, Canine, C-GFPSpark® tag DG70026-ACG
    EGFR cDNA ORF Clone, Canine, C-OFPSpark® tag DG70026-ACR
    EGFR cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70026-CF
    EGFR cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70026-NF
    EGFR cDNA ORF Clone, Canine, C-His tag DG70026-CH
    EGFR cDNA ORF Clone, Canine, C-His tag DG70026-G-H
    EGFR cDNA ORF Clone, Canine, N-His tag DG70026-NH
    EGFR cDNA ORF Clone, Canine, C-HA tag DG70026-CY
    EGFR cDNA ORF Clone, Canine, N-HA tag DG70026-NY
    EGFR cDNA ORF Clone, Canine, C-Myc tag DG70026-CM
    EGFR cDNA ORF Clone, Canine, N-Myc tag DG70026-NM

    EGFR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EGFR cDNA ORF Clone in Cloning Vector, Rat RG80100-G
    EGFR cDNA ORF Clone, Rat, untagged RG80100-UT
    EGFR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80100-ACG
    EGFR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80100-ACGLN
    EGFR cDNA ORF Clone, Rat, N-GFPSpark® tag RG80100-ANG
    EGFR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80100-ACR
    EGFR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80100-CF
    EGFR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80100-NF
    EGFR cDNA ORF Clone, Rat, C-His tag RG80100-CH
    EGFR cDNA ORF Clone, Rat, N-His tag RG80100-NH
    EGFR cDNA ORF Clone, Rat, C-HA tag RG80100-CY
    EGFR cDNA ORF Clone, Rat, N-HA tag RG80100-NY
    EGFR cDNA ORF Clone, Rat, N-Myc tag RG80100-NM
    EGFR qPCR Primer Pairs, Rat RP300096

    EGFR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EGFR cDNA ORF Clone in Cloning Vector, Mouse MG51091-G
    EGFR cDNA ORF Clone, Mouse, untagged MG51091-UT
    EGFR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51091-ACG
    EGFR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51091-ACGLN
    EGFR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51091-ACR
    EGFR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51091-CF
    EGFR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51091-NF
    EGFR cDNA ORF Clone, Mouse, C-His tag MG51091-CH
    EGFR cDNA ORF Clone, Mouse, N-His tag MG51091-NH
    EGFR cDNA ORF Clone, Mouse, C-HA tag MG51091-CY
    EGFR cDNA ORF Clone, Mouse, N-HA tag MG51091-NY
    EGFR cDNA ORF Clone, Mouse, C-Myc tag MG51091-CM
    EGFR cDNA ORF Clone, Mouse, N-Myc tag MG51091-NM
    EGFR qPCR Primer Pairs, Mouse MP201029

    EGFR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EGFR cDNA ORF Clone, Human, untagged HG10001-UT
    EGFR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10001-ACGLN
    EGFR cDNA ORF Clone, Human, C-GFPSpark® tag HG10001-ACG
    EGFR cDNA ORF Clone, Human, C-OFPSpark® tag HG10001-ACR
    EGFR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10001-CF
    EGFR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10001-NF
    EGFR cDNA ORF Clone, Human, C-His tag HG10001-CH
    EGFR cDNA ORF Clone, Human, N-His tag HG10001-NH
    EGFR cDNA ORF Clone, Human, C-HA tag HG10001-CY
    EGFR cDNA ORF Clone, Human, N-HA tag HG10001-NY
    EGFR cDNA ORF Clone, Human, C-Myc tag HG10001-CM
    EGFR cDNA ORF Clone, Human, N-Myc tag HG10001-NM
    EGFR qPCR Primer Pairs, Human HP100094
    info info
    添加购物车成功! 添加购物车失败!